Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36381
Trapped Gene
Ppil6 (ENSMUSG00000078451)
Vector Insertion
Chr 10: 41210428 - 41214324
Public Clones IST12310E5 (tigm) IST12310E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666469 (Chr10:41210284..41210427 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCAAAGACCATCGCTGAG Chr10:41210408..41210427 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666469 (Chr10:41210284..41210427 +)
Downstram Exon
ENSMUSE00000666468 (Chr10:41214325..41214420 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCAAAGACCATCGCTGAG Chr10:41210408..41210427 59.98 50 TCCAGAAACTGATCCCAAGC Chr10:41214410..41214429 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666469 Chr10:41210284..41210427 TGTCAAAGACCATCGCTGAG Chr10:41210408..41210427 59.98 50

*** Putative Vector Insertion (Chr 10: 41210428 - 41214324) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666468 Chr10:41214325..41214420 TCCAGAAACTGATCCCAAGC Chr10:41214410..41214429 60.19 50
downstream ENSMUSE00000666467 Chr10:41218168..41218356 CAAATGCGTTACCCAGGAGT Chr10:41218249..41218268 59.99 50
downstream ENSMUSE00000666466 Chr10:41221431..41221493 No primer for this exon
downstream ENSMUSE00000666465 Chr10:41221590..41221737 TCTGGGACATGCATCACAAT Chr10:41221616..41221635 59.92 45
downstream ENSMUSE00000666464 Chr10:41222802..41222858 No primer for this exon
downstream ENSMUSE00000666462 Chr10:41227230..41227365 TTGGTGTGATGGCCCTTATT Chr10:41227302..41227321 60.19 45
downstream ENSMUSE00000666461 Chr10:41233897..41234092 TGCTTAAGAACGTGGGTTCC Chr10:41233932..41233951 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACACATGTAATCGCCTTG Chr10:41213470..41213490 60.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCCTGTTTCGCACACAT Chr10:41213458..41213478 59.17 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078451