Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36383
Trapped Gene
Iars (ENSMUSG00000037851)
Vector Insertion
Chr 13: 49818446 - 49819986
Public Clones IST10091G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454996 (Chr13:49818362..49818445 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCATCCACCAAGACCCAGA Chr13:49818383..49818402 60.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454996 (Chr13:49818362..49818445 +)
Downstram Exon
ENSMUSE00000274186 (Chr13:49819987..49820161 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCATCCACCAAGACCCAGA Chr13:49818383..49818402 60.93 55 TCAGCCCTTAGTCGGATACC Chr13:49820057..49820076 59.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000571016 Chr13:49777512..49777572 No primer for this exon
upstream ENSMUSE00000274352 Chr13:49782755..49782880 CCAGGAATGCCTCAAACAGT Chr13:49782845..49782864 60.11 50
upstream ENSMUSE00000274347 Chr13:49783526..49783682 TTTGCTACTGGACTGCCTCA Chr13:49783551..49783570 59.59 50
upstream ENSMUSE00000274340 Chr13:49783893..49784012 CAAAATGGGGATTGCAGAGT Chr13:49783943..49783962 59.93 45
upstream ENSMUSE00000274333 Chr13:49785817..49785899 CGATGGATCGACTTTGACAAT Chr13:49785838..49785858 59.95 42.86
upstream ENSMUSE00000274328 Chr13:49786863..49786980 TCGTGTACAGAGGCGTGAAG Chr13:49786895..49786914 60.05 55
upstream ENSMUSE00000274324 Chr13:49788393..49788540 GCACTATGCGTCAATCCAGA Chr13:49788498..49788517 59.83 50
upstream ENSMUSE00000274318 Chr13:49797213..49797300 TTCATCTTAACGGAAGCCAGA Chr13:49797233..49797253 59.83 42.86
upstream ENSMUSE00000274310 Chr13:49797857..49797917 GCCTCTCTCAAAGGCAAGAA Chr13:49797867..49797886 59.69 50
upstream ENSMUSE00000274305 Chr13:49798536..49798631 GCACCAGGCTCCTTACTTTG Chr13:49798607..49798626 59.88 55
upstream ENSMUSE00000274300 Chr13:49799640..49799762 TTTGTGGGGCAGTATGTGAA Chr13:49799742..49799761 59.96 45
upstream ENSMUSE00000274293 Chr13:49800202..49800293 GGCACGTTCACTCACAGCTA Chr13:49800259..49800278 60.06 55
upstream ENSMUSE00000274285 Chr13:49801156..49801254 AGACACGCCCCTCATTTACA Chr13:49801159..49801178 60.52 50
upstream ENSMUSE00000274280 Chr13:49802048..49802174 ACTGTGGGTCAGCGAAGACT Chr13:49802147..49802166 59.91 55
upstream ENSMUSE00000274274 Chr13:49803775..49803848 AGTGTGCATTGGATCAGTGG Chr13:49803777..49803796 59.55 50
upstream ENSMUSE00000274263 Chr13:49804948..49805142 TGTTTGACTGCTGGTTCGAG Chr13:49805010..49805029 60.03 50
upstream ENSMUSE00000274254 Chr13:49807119..49807205 TTGTGAATGGCCTCATCTTG Chr13:49807181..49807200 59.65 45
upstream ENSMUSE00000274245 Chr13:49810183..49810266 AATGAGCAAGCGGAAAAAGA Chr13:49810195..49810214 59.96 40
upstream ENSMUSE00000274234 Chr13:49811054..49811198 GGTACAACGCTTACCGCTTC Chr13:49811149..49811168 59.78 55
upstream ENSMUSE00000409256 Chr13:49813275..49813395 AGTCGCTCCTTGGCTTCTTT Chr13:49813360..49813379 60.52 50
upstream ENSMUSE00000407370 Chr13:49814947..49815038 TACCTCGCCTGGTCAAGTTT Chr13:49814968..49814987 59.73 50
upstream ENSMUSE00000455011 Chr13:49816450..49816527 GGGGTGGAAGACTGTGTCAT Chr13:49816459..49816478 59.82 55
upstream ENSMUSE00000455005 Chr13:49817515..49817636 AGCTGCTGATTGATCCTGCT Chr13:49817561..49817580 60.13 50
upstream ENSMUSE00000274205 Chr13:49818039..49818141 TGCAGTCTGTGATCGAGCTT Chr13:49818083..49818102 59.73 50
upstream ENSMUSE00000454996 Chr13:49818362..49818445 GTCATCCACCAAGACCCAGA Chr13:49818383..49818402 60.93 55

*** Putative Vector Insertion (Chr 13: 49818446 - 49819986) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274186 Chr13:49819987..49820161 TCAGCCCTTAGTCGGATACC Chr13:49820057..49820076 59.15 55
downstream ENSMUSE00000274178 Chr13:49820590..49820702 ACATGAGGCGAATGTCTTCC Chr13:49820646..49820665 60.08 50
downstream ENSMUSE00000274170 Chr13:49821528..49821623 AGCTTCTGGATGCGATTGAT Chr13:49821616..49821635 59.8 45
downstream ENSMUSE00000274159 Chr13:49822496..49822672 ATTTCATCCGTTGGAACCAG Chr13:49822524..49822543 59.79 45
downstream ENSMUSE00000274151 Chr13:49824028..49824133 CACACACGATCCTTTGGTGA Chr13:49824078..49824097 60.57 50
downstream ENSMUSE00000274146 Chr13:49825384..49825509 TCACCTTTCGGATTCTCCAG Chr13:49825420..49825439 60.19 50
downstream ENSMUSE00000274139 Chr13:49826787..49826930 CAGTCACACACAGCGTCCTC Chr13:49826846..49826865 60.53 60
downstream ENSMUSE00000274135 Chr13:49827709..49827861 TTCTGTCCGAGTGGGTTTTC Chr13:49827766..49827785 60.09 50
downstream ENSMUSE00000365150 Chr13:49829028..49829628 GCAGTTGTTGGCAAGACAGA Chr13:49829103..49829122 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr13:49818496..49818516 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTATTCGTGACTGGGAAAACC Chr13:49818491..49818513 59.25 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037851