Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36384
Trapped Gene
B230208H17Rik (ENSMUSG00000015087)
Vector Insertion
Chr 2: 25457940 - 25463967
Public Clones IST10091G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000353011 (Chr2:25463633..25463966 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGCTAAGGGGGTTCAGT Chr2:25463639..25463658 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000353011 (Chr2:25463633..25463966 -)
Downstram Exon
ENSMUSE00000239043 (Chr2:25457941..25458075 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGCTAAGGGGGTTCAGT Chr2:25463639..25463658 60.62 55 ATGCTGGTGACCTGGATCTC Chr2:25457936..25457955 60.08 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353011 Chr2:25463633..25463966 CTTCGCTAAGGGGGTTCAGT Chr2:25463639..25463658 60.62 55
upstream ENSMUSE00000239043 Chr2:25457941..25458075 CTGCAGGGCAAGAAGTTTGT Chr2:25458000..25458019 60.43 50

*** Putative Vector Insertion (Chr 2: 25457940 - 25463967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239036 Chr2:25456871..25456918 No primer for this exon
downstream ENSMUSE00000239031 Chr2:25453665..25453717 TTTCCGTCTTCAAGCCATCT Chr2:25453657..25453676 59.81 45
downstream ENSMUSE00000164477 Chr2:25451953..25452044 ATCCAGGGCCAATTCAGACT Chr2:25451999..25452018 60.85 50
downstream ENSMUSE00000164469 Chr2:25448287..25448427 GCTCCCGGAGAACATAATTG Chr2:25448380..25448399 59.53 50
downstream ENSMUSE00000164473 Chr2:25447818..25447923 TTGCAAAAATGGGATGTTGA Chr2:25447802..25447821 59.91 35
downstream ENSMUSE00000334004 Chr2:25444129..25444232 TGGCATCGATGTCTAGTTGG Chr2:25444159..25444178 59.67 50
downstream ENSMUSE00000366745 Chr2:25442795..25443147 CCAAACAGCCGAGAGATGAT Chr2:25442811..25442830 60.22 50
downstream ENSMUSE00000164474 Chr2:25442388..25442538 CTGGACTCTTGCTGGAGCTT Chr2:25442479..25442498 59.74 55
downstream ENSMUSE00000164467 Chr2:25441144..25441353 CCACATCATCCTGGAAACCT Chr2:25441273..25441292 59.78 50
downstream ENSMUSE00000164478 Chr2:25440828..25441056 CCCCTCAGGATCACTCTCTG Chr2:25440887..25440906 59.78 60
downstream ENSMUSE00000379055 Chr2:25440296..25440464 AGCCCAAAGAGATCGGAGTC Chr2:25440315..25440334 60.74 55
downstream ENSMUSE00000416090 Chr2:25439623..25439681 CTCCTTAGAGGGAAGTTTGCTG Chr2:25439631..25439652 59.54 50
downstream ENSMUSE00000569209 Chr2:25438539..25439508 CAATTGCCCTAGGCATGTTT Chr2:25439271..25439290 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCTTTTAGCGTCCCGTA Chr2:25460989..25461009 61.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCCTTTTAGCGTCCCGTA Chr2:25460989..25461009 61.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015087