Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36389
Trapped Gene
Fbxl10 (ENSMUSG00000029475)
Vector Insertion
Chr 5: 123320687 - 123328663
Public Clones (ggtc) (cmhd) IST14794B12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189233 (Chr5:123328444..123328662 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCTCTCGAAGCTCCAACT Chr5:123328539..123328558 59.89 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189233 (Chr5:123328444..123328662 -)
Downstram Exon
ENSMUSE00000719227 (Chr5:123320688..123321906 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCTCTCGAAGCTCCAACT Chr5:123328539..123328558 59.89 55 TGCATCAGGGAAAGGTTAGG Chr5:123320702..123320721 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717210 Chr5:123439634..123439832 CGCAAATGGATAAGGGTCTG Chr5:123439731..123439750 60.46 50
upstream ENSMUSE00000518745 Chr5:123438877..123438909 No primer for this exon
upstream ENSMUSE00000714097 Chr5:123438877..123439315 TTACGTTCCGGGGATTATGA Chr5:123439130..123439149 60.15 45
upstream ENSMUSE00000593008 Chr5:123438476..123438542 GGGGAGTCTCCTTAGGAAGTG Chr5:123438516..123438536 59.19 57.14
upstream ENSMUSE00000338385 Chr5:123437671..123437815 TATACCAGGGGGACTTCGTG Chr5:123437690..123437709 59.81 55
upstream ENSMUSE00000376150 Chr5:123434471..123434549 TTCGGGACAAGGATGGACTA Chr5:123434479..123434498 60.45 50
upstream ENSMUSE00000328593 Chr5:123432786..123432832 TGATTTCACAGTCCGAGACG Chr5:123432801..123432820 59.83 50
upstream ENSMUSE00000328661 Chr5:123411419..123411597 CCAGAAGGGTACCGAGATGA Chr5:123411541..123411560 60.06 55
upstream ENSMUSE00000328656 Chr5:123411022..123411128 GTGGCCTCAGCATCTAAAGG Chr5:123411080..123411099 59.84 55
upstream ENSMUSE00000328651 Chr5:123399079..123399172 ACCTCCGTGTGGTACCATGT Chr5:123399095..123399114 60.16 55
upstream ENSMUSE00000328643 Chr5:123397736..123397889 GTACGAGGAGTGGGTGCTGT Chr5:123397829..123397848 60.18 60
upstream ENSMUSE00000328635 Chr5:123390962..123391077 GGATCCATGCGGTTTATACG Chr5:123391055..123391074 60.17 50
upstream ENSMUSE00000328629 Chr5:123384742..123384868 GTTCAGCCCAAGTTCCGTTA Chr5:123384849..123384868 60.11 50
upstream ENSMUSE00000331402 Chr5:123382476..123382960 AGGACAAGGAGGAGGAAGGA Chr5:123382836..123382855 60.19 55
upstream ENSMUSE00000382139 Chr5:123371394..123371480 CTGAAAGAGCACGTGGATGA Chr5:123371455..123371474 59.98 50
upstream ENSMUSE00000537526 Chr5:123350158..123350359 CCGAGGACGACGACTATGAA Chr5:123350173..123350192 61.2 55
upstream ENSMUSE00000328745 Chr5:123338539..123338763 AGAGTGCCACTTTTGCAAGG Chr5:123338604..123338623 60.43 50
upstream ENSMUSE00000437855 Chr5:123333328..123333471 TCTGCAACGAGATCATCCAC Chr5:123333343..123333362 59.79 50
upstream ENSMUSE00000247403 Chr5:123332411..123332497 TTAAGGAATCGGAGGGTGTG Chr5:123332477..123332496 59.93 50
upstream ENSMUSE00000437831 Chr5:123331973..123332233 AGATGAACCGGGACAACAAG Chr5:123332150..123332169 59.97 50
upstream ENSMUSE00000437825 Chr5:123331646..123331759 CCCTCTAGGCAGCAGTCTCA Chr5:123331687..123331706 60.69 60
upstream ENSMUSE00000437822 Chr5:123331029..123331067 No primer for this exon
upstream ENSMUSE00000412900 Chr5:123330182..123330861 TCAGTCACGTTCCAGCTCAC Chr5:123330723..123330742 60.03 55
upstream ENSMUSE00000189235 Chr5:123329498..123329661 CAGCTGAGTTGGCTCATCAA Chr5:123329509..123329528 60.14 50
upstream ENSMUSE00000189228 Chr5:123329254..123329415 AGCTCCAGTTGTCCATTGCT Chr5:123329340..123329359 59.87 50
upstream ENSMUSE00000189233 Chr5:123328444..123328662 CTGCTCTCGAAGCTCCAACT Chr5:123328539..123328558 59.89 55
upstream ENSMUSE00000716214 Chr5:123321714..123321906 ATTTGGGCAAGTGGAAGAGA Chr5:123321748..123321767 59.67 45
upstream ENSMUSE00000593009 Chr5:123320690..123321906 TTGTTCCTTGCAATGCTGAG Chr5:123321351..123321370 59.99 45
upstream ENSMUSE00000719227 Chr5:123320688..123321906 TTGTTCCTTGCAATGCTGAG Chr5:123321351..123321370 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTCGCCCTGACTTTTATT Chr5:123322621..123322641 59.85 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTCGCCCTGACTTTTATT Chr5:123322621..123322641 59.85 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029475