Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36390
Trapped Gene
3110001I22Rik (ENSMUSG00000079737)
Vector Insertion
Chr 16: 13672172 - 13676926
Public Clones (sanger) IST12511A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263087 (Chr16:13672113..13672171 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACAGAGTGGGTACCAGGA Chr16:13672141..13672160 59.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263087 (Chr16:13672113..13672171 +)
Downstram Exon
ENSMUSE00000263079 (Chr16:13676927..13678478 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACAGAGTGGGTACCAGGA Chr16:13672141..13672160 59.1 55 GCATGCTCGGACTTCCTAAG Chr16:13677520..13677539 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263087 Chr16:13672113..13672171 TGACAGAGTGGGTACCAGGA Chr16:13672141..13672160 59.1 55

*** Putative Vector Insertion (Chr 16: 13672172 - 13676926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000263079 Chr16:13676927..13678478 GCATGCTCGGACTTCCTAAG Chr16:13677520..13677539 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACAGAGTGGGTACCAGGAC Chr16:13675142..13675163 60.02 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACAGAGTGGGTACCAGGAC Chr16:13675142..13675163 60.02 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079737