Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36392
Trapped Gene
St8sia6 (ENSMUSG00000003418)
Vector Insertion
Chr 2: 13645069 - 13714480
Public Clones IST14730C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387575 (Chr2:13714381..13714479 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387575 (Chr2:13714381..13714479 -)
Downstram Exon
ENSMUSE00000421340 (Chr2:13645070..13645159 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000647487 Chr2:13714971..13715689 No primer for this exon
upstream ENSMUSE00000387575 Chr2:13714381..13714479 No primer for this exon
upstream ENSMUSE00000421340 Chr2:13645070..13645159 No primer for this exon

*** Putative Vector Insertion (Chr 2: 13645069 - 13714480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000420853 Chr2:13618455..13618541 No primer for this exon
downstream ENSMUSE00000342151 Chr2:13594110..13594254 No primer for this exon
downstream ENSMUSE00000352003 Chr2:13590412..13590524 No primer for this exon
downstream ENSMUSE00000420833 Chr2:13587047..13587139 No primer for this exon
downstream ENSMUSE00000270283 Chr2:13576567..13578917 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGATGGAGGGAAGCAGAG Chr2:13660455..13660475 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGATGGAGGGAAGCAGAG Chr2:13660455..13660475 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003418