Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36394
Trapped Gene
Otud5 (ENSMUSG00000031154)
Vector Insertion
Chr X: 7419837 - 7433429
Public Clones IST14730C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703766 (ChrX:7418982..7419836 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGCTGTGGGGTACTTGG ChrX:7419213..7419232 60.54 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703766 (ChrX:7418982..7419836 +)
Downstram Exon
ENSMUSE00000241708 (ChrX:7433430..7433523 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGCTGTGGGGTACTTGG ChrX:7419213..7419232 60.54 55 AATAGACAGGCACCGTCCTC ChrX:7433515..7433534 59.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703766 ChrX:7418982..7419836 CTTTGCTGTGGGGTACTTGG ChrX:7419213..7419232 60.54 55
upstream ENSMUSE00000703776 ChrX:7419208..7419594 CTTTGCTGTGGGGTACTTGG ChrX:7419213..7419232 60.54 55
upstream ENSMUSE00000703765 ChrX:7419242..7419594 AGGCTTCTCCACCTCCTTGT ChrX:7419532..7419551 60.25 55
upstream ENSMUSE00000241716 ChrX:7419243..7419836 AGTCCGGAACGTGAAGAGGT ChrX:7419735..7419754 61.08 55
upstream ENSMUSE00000703775 ChrX:7419724..7419836 AGTCCGGAACGTGAAGAGGT ChrX:7419735..7419754 61.08 55

*** Putative Vector Insertion (Chr X: 7419837 - 7433429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000241708 ChrX:7433430..7433523 AATAGACAGGCACCGTCCTC ChrX:7433515..7433534 59.17 55
downstream ENSMUSE00000206921 ChrX:7444641..7444705 CATGCAATGCTTTCGAACAA ChrX:7444699..7444718 60.79 40
downstream ENSMUSE00000241693 ChrX:7444793..7444949 TCCGCTTCCGGTTGATATAG ChrX:7444865..7444884 60.05 50
downstream ENSMUSE00000703768 ChrX:7444793..7444964 TCCGCTTCCGGTTGATATAG ChrX:7444865..7444884 60.05 50
downstream ENSMUSE00000206923 ChrX:7445049..7445197 CCCTGGCTTAAATGACGGTA ChrX:7445200..7445219 59.95 50
downstream ENSMUSE00000206922 ChrX:7449122..7449325 CCCTCAGCCACTGAAGGTAA ChrX:7449287..7449306 60.25 55
downstream ENSMUSE00000703764 ChrX:7449122..7449307 CCCTCAGCCACTGAAGGTAA ChrX:7449287..7449306 60.25 55
downstream ENSMUSE00000241673 ChrX:7450680..7450881 CCGACTAGTCCATTCCTCCA ChrX:7450757..7450776 60.06 55
downstream ENSMUSE00000206924 ChrX:7450966..7451079 AGCAGGGTAGAGGGACACAA ChrX:7451036..7451055 59.72 55
downstream ENSMUSE00000348974 ChrX:7451356..7451986 TCTCATCATCGTCCCAATCA ChrX:7451388..7451407 60.01 45
downstream ENSMUSE00000703763 ChrX:7451359..7453746 TCTCATCATCGTCCCAATCA ChrX:7451388..7451407 60.01 45
downstream ENSMUSE00000703769 ChrX:7451359..7451980 TCTCATCATCGTCCCAATCA ChrX:7451388..7451407 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGGTAAGGGCTGGAAGGT ChrX:7422834..7422854 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACTCCGTGACTGGGAAAA ChrX:7422882..7422902 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031154