Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36397
Trapped Gene
Nck1 (ENSMUSG00000032475)
Vector Insertion
Chr 9: 100397676 - 100407276
Public Clones IST10725F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693492 (Chr9:100407145..100407275 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAAATTATCCCGGAGCTG Chr9:100407222..100407241 60.03 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693492 (Chr9:100407145..100407275 -)
Downstram Exon
ENSMUSE00000219930 (Chr9:100397677..100398389 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAAATTATCCCGGAGCTG Chr9:100407222..100407241 60.03 45 GTCATTTTCCGGCTTTTCAA Chr9:100397916..100397935 60.05 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219928 Chr9:100446414..100446472 No primer for this exon
upstream ENSMUSE00000219929 Chr9:100408848..100409091 AAACAGTGCTCGGAAAGCAT Chr9:100408878..100408897 59.88 45
upstream ENSMUSE00000706789 Chr9:100408848..100409073 AAACAGTGCTCGGAAAGCAT Chr9:100408878..100408897 59.88 45
upstream ENSMUSE00000693492 Chr9:100407145..100407275 TGAAAATTATCCCGGAGCTG Chr9:100407222..100407241 60.03 45
upstream ENSMUSE00000219930 Chr9:100397677..100398389 GGCAGCTACAACGGACAAAT Chr9:100398161..100398180 60.14 50

*** Putative Vector Insertion (Chr 9: 100397676 - 100407276) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394476 Chr9:100395424..100396090 AGTACAATTGGCCCAGCACT Chr9:100395792..100395811 59.62 50
downstream ENSMUSE00000633171 Chr9:100392712..100396090 GGTGTCCGTACTCTGGCAAT Chr9:100393103..100393122 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACATTTAATCGCCTTGCAG Chr9:100407211..100407232 59.27 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACATTCGTGACTGGGAAAA Chr9:100404211..100404231 58.05 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032475