Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3641
Trapped Gene
CT025556.12 (ENSMUSG00000074800)
Vector Insertion
Chr 13: 75782611 - 75782611
Public Clones BA0201 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641125 (Chr13:75782344..75782610 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGGAAAATGGTGAAGAA Chr13:75782407..75782426 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641125 (Chr13:75782344..75782610 +)
Downstram Exon
ENSMUSE00000641124 (Chr13:75782612..75782638 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGGAAAATGGTGAAGAA Chr13:75782407..75782426 60.04 45 GACAGCAGGGCTTCTACTGG Chr13:75782638..75782657 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641125 Chr13:75782344..75782610 CTCCGGAAAATGGTGAAGAA Chr13:75782407..75782426 60.04 45

*** Putative Vector Insertion (Chr 13: 75782611 - 75782611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641124 Chr13:75782612..75782638 GACAGCAGGGCTTCTACTGG Chr13:75782638..75782657 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACTGATAATCGCCTTGCAG Chr13:75782606..75782627 59.86 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACTGACGTGACTGGGAAA Chr13:75782606..75782626 58.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074800