Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36430
Trapped Gene
Parp4 (ENSMUSG00000054509)
Vector Insertion
Chr 14: 57260155 - 57266010
Public Clones IST13311A11 (tigm) IST13908D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000429782 (Chr14:57260092..57260154 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGCCATGGAGTGCTACAG Chr14:57260135..57260154 61.09 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000429782 (Chr14:57260092..57260154 +)
Downstram Exon
ENSMUSE00000429778 (Chr14:57266011..57266064 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGCCATGGAGTGCTACAG Chr14:57260135..57260154 61.09 55 CTTCAGAGGAGACGGAAACG Chr14:57266035..57266054 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000558619 Chr14:57194494..57194567 No primer for this exon
upstream ENSMUSE00000558618 Chr14:57202996..57203128 ATGGCGGAAAGTTTTCCTTT Chr14:57203094..57203113 59.94 40
upstream ENSMUSE00000558617 Chr14:57204394..57204589 TCCAAAAGAACGATGTGCAG Chr14:57204452..57204471 59.84 45
upstream ENSMUSE00000558616 Chr14:57206586..57206649 GACAACACCCCAGAGAAGGA Chr14:57206612..57206631 60.09 55
upstream ENSMUSE00000558615 Chr14:57207256..57207331 CCCCCTTTCTTCAAGACTTTG Chr14:57207282..57207302 60.09 47.62
upstream ENSMUSE00000558614 Chr14:57208716..57208817 AGAGCTGCCCCTTTGTGATA Chr14:57208768..57208787 59.84 50
upstream ENSMUSE00000558613 Chr14:57209201..57209350 GCAAACTTCTGAAGGTGCAA Chr14:57209224..57209243 59.05 45
upstream ENSMUSE00000558612 Chr14:57211128..57211265 GTGAACAGCATGAGCCTGAA Chr14:57211242..57211261 59.99 50
upstream ENSMUSE00000558611 Chr14:57212061..57212234 AGGCTGTTGGCTCAAAAAGA Chr14:57212202..57212221 59.99 45
upstream ENSMUSE00000558610 Chr14:57214091..57214251 CTTGCCAAATACCGTGCTTT Chr14:57214151..57214170 60.13 45
upstream ENSMUSE00000558609 Chr14:57216413..57216550 GATCTCCTGTGCGGAACATT Chr14:57216514..57216533 60.08 50
upstream ENSMUSE00000558608 Chr14:57217169..57217264 GACCGCGGTGTACAGAGAAC Chr14:57217197..57217216 60.72 60
upstream ENSMUSE00000558607 Chr14:57221101..57221284 GTATGCACACGCAGGAGAGA Chr14:57221113..57221132 60.02 55
upstream ENSMUSE00000558606 Chr14:57221588..57221744 TAGAGGAGCAAAGGGCTGAG Chr14:57221700..57221719 59.71 55
upstream ENSMUSE00000429880 Chr14:57226259..57226383 TCTGCGAATCCTGTTCCTCT Chr14:57226318..57226337 59.95 50
upstream ENSMUSE00000429864 Chr14:57227198..57227329 AAAGCCACGTGCCTATTGAG Chr14:57227226..57227245 60.27 50
upstream ENSMUSE00000429860 Chr14:57229591..57229677 GGAGTACCGAGAGGCTGTCA Chr14:57229617..57229636 60.41 60
upstream ENSMUSE00000429852 Chr14:57232491..57232655 CGGGCTAAAGTCCTCATCAA Chr14:57232527..57232546 60.21 50
upstream ENSMUSE00000429847 Chr14:57233237..57233283 GGAAATTGGAGCAGAGCAAA Chr14:57233263..57233282 60.33 45
upstream ENSMUSE00000429841 Chr14:57233524..57233602 CCCTGGCTATGTCCATTGAG Chr14:57233529..57233548 60.47 55
upstream ENSMUSE00000429835 Chr14:57235169..57235306 GACAGCGGTGGATTTTCTCT Chr14:57235217..57235236 59.29 50
upstream ENSMUSE00000429829 Chr14:57239291..57239486 TTGTCTTTCAACCGGAGCTT Chr14:57239301..57239320 59.85 45
upstream ENSMUSE00000429822 Chr14:57241021..57241088 CCTAAGTGCATCACGGACAG Chr14:57241044..57241063 59.31 55
upstream ENSMUSE00000429814 Chr14:57242854..57243041 ATATCTGATGGGCACCTCCA Chr14:57242950..57242969 60.3 50
upstream ENSMUSE00000429808 Chr14:57246227..57246326 CCACAGCAAATCGTCACATC Chr14:57246229..57246248 60.12 50
upstream ENSMUSE00000429800 Chr14:57247911..57248081 ACTCCTGGTCTACGGCTTCA Chr14:57248045..57248064 59.87 55
upstream ENSMUSE00000558605 Chr14:57248304..57248384 CTGCAAGCATTCATCCAAGA Chr14:57248310..57248329 59.95 45
upstream ENSMUSE00000429793 Chr14:57253049..57253129 CATTCTCCACGACGATGAAA Chr14:57253099..57253118 59.65 45
upstream ENSMUSE00000429789 Chr14:57254564..57254659 ACAAGCTTTGTGGCAGTTGA Chr14:57254633..57254652 59.49 45
upstream ENSMUSE00000429786 Chr14:57256685..57256807 CATACGTGAGTTGGCAGGAA Chr14:57256761..57256780 59.72 50
upstream ENSMUSE00000429782 Chr14:57260092..57260154 ATGGCCATGGAGTGCTACAG Chr14:57260135..57260154 61.09 55

*** Putative Vector Insertion (Chr 14: 57260155 - 57266010) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000429778 Chr14:57266011..57266064 CTTCAGAGGAGACGGAAACG Chr14:57266035..57266054 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACCTGGATGTGCAACATTA Chr14:57260136..57260157 59.98 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACCTGGATGTGCAACATTA Chr14:57260136..57260157 59.98 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054509