Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36435
Trapped Gene
Wdr22 (ENSMUSG00000049106)
Vector Insertion
Chr 12: 81505541 - 81537589
Public Clones IST14872E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000417894 (Chr12:81537172..81537588 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCAGTGGTGGGCTTCTTGT Chr12:81537331..81537350 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000417894 (Chr12:81537172..81537588 -)
Downstram Exon
ENSMUSE00000279401 (Chr12:81505542..81505685 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCAGTGGTGGGCTTCTTGT Chr12:81537331..81537350 60.16 55 TTGACCCTGGAATGGATAGC Chr12:81505603..81505622 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000417894 Chr12:81537172..81537588 GTCAGTGGTGGGCTTCTTGT Chr12:81537331..81537350 60.16 55
upstream ENSMUSE00000279401 Chr12:81505542..81505685 GCTATCCATTCCAGGGTCAA Chr12:81505625..81505644 59.89 50

*** Putative Vector Insertion (Chr 12: 81505541 - 81537589) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000114879 Chr12:81500936..81500972 No primer for this exon
downstream ENSMUSE00000114878 Chr12:81499756..81499895 GACTCCCGGATATCCCAAAT Chr12:81499745..81499764 59.98 50
downstream ENSMUSE00000114875 Chr12:81498640..81498769 GGGGTTAAACATGACGCTGT Chr12:81498692..81498711 59.86 50
downstream ENSMUSE00000417866 Chr12:81477505..81477718 GTTGAATCGCACACTCATGG Chr12:81477636..81477655 60.12 50
downstream ENSMUSE00000353985 Chr12:81464991..81465057 AAGTCATCGGAGCCTGAAAG Chr12:81465010..81465029 59.43 50
downstream ENSMUSE00000279345 Chr12:81449307..81449434 ACCATGAAGGCTCCATTGAC Chr12:81449376..81449395 59.93 50
downstream ENSMUSE00000341093 Chr12:81437676..81441263 AGTTCAGGTGGAACCCACAG Chr12:81438458..81438477 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGTCCTGTTAATCGCCTTG Chr12:81513527..81513548 59.62 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGTCGTGACTGGGAAAA Chr12:81513524..81513544 61.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049106