Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36436
Trapped Gene
Trak1 (ENSMUSG00000032536)
Vector Insertion
Chr 9: 121276310 - 121300974
Public Clones IST14872E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000259358 (Chr9:121276076..121276309 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCTTGGGAAAACTGCTGA Chr9:121276124..121276143 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000259358 (Chr9:121276076..121276309 +)
Downstram Exon
ENSMUSE00000633536 (Chr9:121300975..121301169 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCTTGGGAAAACTGCTGA Chr9:121276124..121276143 59.99 45 AGCGTCTCTTCGATCTGCTC Chr9:121301161..121301180 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633538 Chr9:121206620..121206951 CTACGCTGAGCCTCGCAGTC Chr9:121206831..121206850 63.67 65
upstream ENSMUSE00000633537 Chr9:121273119..121273417 GGAAGATGCTCCCAGCTACA Chr9:121273368..121273387 60.36 55
upstream ENSMUSE00000259358 Chr9:121276076..121276309 AAGCTTGGGAAAACTGCTGA Chr9:121276124..121276143 59.99 45

*** Putative Vector Insertion (Chr 9: 121276310 - 121300974) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000528168 Chr9:121300975..121301169 AGCGTCTCTTCGATCTGCTC Chr9:121301161..121301180 59.86 55
downstream ENSMUSE00000633536 Chr9:121300975..121301169 AGCGTCTCTTCGATCTGCTC Chr9:121301161..121301180 59.86 55
downstream ENSMUSE00000520674 Chr9:121340597..121340673 AGCCTCGTGACAGCATCAAT Chr9:121340666..121340685 60.83 50
downstream ENSMUSE00000220555 Chr9:121349788..121349904 ATGTGCTCCACCTGCTCTTC Chr9:121349897..121349916 60.42 55
downstream ENSMUSE00000220546 Chr9:121351810..121351910 CAGCTCGTCTTTCATGGACA Chr9:121351854..121351873 59.98 50
downstream ENSMUSE00000497415 Chr9:121352744..121352852 GGAGGACTCGTTCCTCTTCA Chr9:121352768..121352787 59.38 55
downstream ENSMUSE00000501964 Chr9:121354933..121355011 CTGCTGCTCCTTCTCCTCATA Chr9:121354985..121355005 59.73 52.38
downstream ENSMUSE00000499273 Chr9:121355808..121355938 TAAGTCCACGATTTGCGACA Chr9:121355923..121355942 60.26 45
downstream ENSMUSE00000510957 Chr9:121357226..121357300 TGCTGGACAAGCTCTTCATT Chr9:121357260..121357279 58.6 45
downstream ENSMUSE00000508239 Chr9:121357940..121358071 CTCCGCGTACTTATCCTCCA Chr9:121357972..121357991 60.23 55
downstream ENSMUSE00000512812 Chr9:121360769..121360845 CGCATAGTTCCCTCGATTTC Chr9:121360806..121360825 59.67 50
downstream ENSMUSE00000507389 Chr9:121362326..121362562 GTTCATGGCTGAGGACTGGT Chr9:121362443..121362462 60.12 55
downstream ENSMUSE00000528159 Chr9:121363397..121363713 ACTCGGAGAAGCGTGAGTGT Chr9:121363638..121363657 60.06 55
downstream ENSMUSE00000633530 Chr9:121363397..121363862 ACTCGGAGAAGCGTGAGTGT Chr9:121363638..121363657 60.06 55
downstream ENSMUSE00000582958 Chr9:121369477..121369695 CTGAATTGGCGTGGAGGTAG Chr9:121369682..121369701 60.65 55
downstream ENSMUSE00000582957 Chr9:121378103..121378205 CGGCAAGTGGTAAAGGTGAA Chr9:121378166..121378185 61.05 50
downstream ENSMUSE00000582956 Chr9:121381355..121384034 CATGGTTGTCGTGGACTCAC Chr9:121381493..121381512 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTTGGGAGTCTTGGGAGA Chr9:121294341..121294361 59.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGTGACTGGGAAAACC Chr9:121294357..121294377 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032536