Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36437
Trapped Gene
4930434E21Rik (ENSMUSG00000029658)
Vector Insertion
Chr 5: 150387092 - 150390644
Public Clones IST14568B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000589270 (Chr5:150387032..150387091 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000589270 (Chr5:150387032..150387091 +)
Downstram Exon
ENSMUSE00000589269 (Chr5:150390645..150390810 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTAACTGGAGGTGGCCAGAA Chr5:150390719..150390738 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684183 Chr5:150331254..150331346 ACAGGCTGATGCCTCTTTGT Chr5:150331298..150331317 59.87 50
upstream ENSMUSE00000589263 Chr5:150332266..150332380 TGGCACCGCTAAAGTAGTCA Chr5:150332301..150332320 59.49 50
upstream ENSMUSE00000712758 Chr5:150332308..150332380 GGACTGGATCGAGGGAAGAG Chr5:150332323..150332342 61.13 60
upstream ENSMUSE00000533218 Chr5:150335235..150335281 TGTTTTTGGCATCTGTAGGTGA Chr5:150335251..150335272 60.53 40.91
upstream ENSMUSE00000721302 Chr5:150335235..150335281 TGTTTTTGGCATCTGTAGGTGA Chr5:150335251..150335272 60.53 40.91
upstream ENSMUSE00000533217 Chr5:150347317..150347434 AGTATGTCCGCTGGAAGGTG Chr5:150347394..150347413 60.13 55
upstream ENSMUSE00000713315 Chr5:150347317..150347434 AGTATGTCCGCTGGAAGGTG Chr5:150347394..150347413 60.13 55
upstream ENSMUSE00000533216 Chr5:150354994..150355063 ATTTCCAGCTCCAATCACGA Chr5:150355024..150355043 60.6 45
upstream ENSMUSE00000718744 Chr5:150354994..150355063 ATTTCCAGCTCCAATCACGA Chr5:150355024..150355043 60.6 45
upstream ENSMUSE00000647562 Chr5:150365791..150365883 CTCCTAAACCGCTTGGAACA Chr5:150365796..150365815 60.24 50
upstream ENSMUSE00000709148 Chr5:150365791..150365883 CTCCTAAACCGCTTGGAACA Chr5:150365796..150365815 60.24 50
upstream ENSMUSE00000721169 Chr5:150365791..150365820 CTCCTAAACCGCTTGGAACA Chr5:150365796..150365815 60.24 50
upstream ENSMUSE00000589262 Chr5:150366758..150367001 ATGTCAAGATGGGGAACAGC Chr5:150366821..150366840 59.93 50
upstream ENSMUSE00000713379 Chr5:150366758..150367001 ATGTCAAGATGGGGAACAGC Chr5:150366821..150366840 59.93 50
upstream ENSMUSE00000533211 Chr5:150366933..150367001 ATCGAATCATCAGGGTCTGG Chr5:150366965..150366984 59.89 50
upstream ENSMUSE00000533210 Chr5:150368938..150369043 TACACGTCGCCTTTGAAGAA Chr5:150368985..150369004 59.46 45
upstream ENSMUSE00000259942 Chr5:150376564..150376715 CTCTGGCTTTCCTTCACCTG Chr5:150376688..150376707 59.98 55
upstream ENSMUSE00000533206 Chr5:150376564..150376715 CTCTGGCTTTCCTTCACCTG Chr5:150376688..150376707 59.98 55
upstream ENSMUSE00000259938 Chr5:150381629..150381731 GGTACAACCCAGCCTTCAGA Chr5:150381685..150381704 60.11 55
upstream ENSMUSE00000533204 Chr5:150381629..150381731 GGTACAACCCAGCCTTCAGA Chr5:150381685..150381704 60.11 55
upstream ENSMUSE00000259929 Chr5:150383191..150383297 AACGGGAAGACAGGTGTCAG Chr5:150383214..150383233 60.15 55
upstream ENSMUSE00000533202 Chr5:150383191..150383297 AACGGGAAGACAGGTGTCAG Chr5:150383214..150383233 60.15 55
upstream ENSMUSE00000444505 Chr5:150383380..150383564 CAGCAAGTGGTCCCCATAAA Chr5:150383479..150383498 60.88 50
upstream ENSMUSE00000533200 Chr5:150383380..150383459 CACTGTCTGCACACCCTTCA Chr5:150383435..150383454 60.94 55
upstream ENSMUSE00000589272 Chr5:150384403..150384457 CATGGAGGTGAACCGAAATC Chr5:150384437..150384456 60.32 50
upstream ENSMUSE00000589271 Chr5:150385662..150385707 TGGATGGGACCGAAGAATAA Chr5:150385677..150385696 60.27 45
upstream ENSMUSE00000589270 Chr5:150387032..150387091 No primer for this exon

*** Putative Vector Insertion (Chr 5: 150387092 - 150390644) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000589269 Chr5:150390645..150390810 GTAACTGGAGGTGGCCAGAA Chr5:150390719..150390738 60.11 55
downstream ENSMUSE00000589268 Chr5:150395670..150395765 AACTTCGTCAGCCGTGTCTT Chr5:150395727..150395746 59.91 50
downstream ENSMUSE00000589267 Chr5:150397049..150397107 GAGGCCAGACCCACTAAAGA Chr5:150397092..150397111 59.28 55
downstream ENSMUSE00000589266 Chr5:150397825..150397966 GCCAGGTAAGCGAGAGTGTC Chr5:150397892..150397911 60.02 60
downstream ENSMUSE00000589265 Chr5:150398891..150398930 GAGCTCTCCAGGATGTCACG Chr5:150398914..150398933 60.98 60
downstream ENSMUSE00000589264 Chr5:150400075..150400163 GTGCAGTCAAGGGAGGAAGA Chr5:150400131..150400150 60.39 55
downstream ENSMUSE00000513994 Chr5:150401779..150401972 AACATCCCAGGGGTGATTCT Chr5:150401813..150401832 60.58 50
downstream ENSMUSE00000533168 Chr5:150402207..150402484 TAGGGTTGAGCATGTTGCTG Chr5:150402257..150402276 59.86 50
downstream ENSMUSE00000684162 Chr5:150402727..150402729 No primer for this exon
downstream ENSMUSE00000684164 Chr5:150408864..150408961 TATCTGCTTTCGCCTCTGCT Chr5:150408933..150408952 60.26 50
downstream ENSMUSE00000684163 Chr5:150414071..150414469 AGGCTTTCTTCGAGCTGACA Chr5:150414098..150414117 60.28 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCACAGTAGCACACACTGAA Chr5:150390116..150390137 59.8 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCTCCGTGACTGGGAAAA Chr5:150390137..150390157 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029658