Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36439
Trapped Gene
Agtr1a (ENSMUSG00000049115)
Vector Insertion
Chr 13: 30436890 - 30472770
Public Clones IST10718E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000358795 (Chr13:30436806..30436889 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCCTCCAAGAAAGCCATC Chr13:30436865..30436884 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000358795 (Chr13:30436806..30436889 +)
Downstram Exon
ENSMUSE00000434856 (Chr13:30472771..30474735 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCCTCCAAGAAAGCCATC Chr13:30436865..30436884 60.44 50 TGAGACACGTGAGCAGGAAC Chr13:30473192..30473211 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343010 Chr13:30428326..30428458 AGTACCAGCTCTGCGGCTCT Chr13:30428417..30428436 61.65 60
upstream ENSMUSE00000358795 Chr13:30436806..30436889 AACCCTCCAAGAAAGCCATC Chr13:30436865..30436884 60.44 50

*** Putative Vector Insertion (Chr 13: 30436890 - 30472770) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434856 Chr13:30472771..30474735 TGAGACACGTGAGCAGGAAC Chr13:30473192..30473211 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTTCAAAGGGCTGGAAGG Chr13:30448872..30448892 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTTCAAAGGGCTGGAAGG Chr13:30448872..30448892 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049115