Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36451
Trapped Gene
Fads6 (ENSMUSG00000044788)
Vector Insertion
Chr 11: 115147431 - 115158019
Public Clones IST15061E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368652 (Chr11:115157852..115158018 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGAGTCCAAACGCTGGAG Chr11:115157880..115157899 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368652 (Chr11:115157852..115158018 -)
Downstram Exon
ENSMUSE00000409260 (Chr11:115147432..115147612 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGAGTCCAAACGCTGGAG Chr11:115157880..115157899 60.44 55 AAACGTAGCGGTTGAGGAGA Chr11:115147464..115147483 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646272 Chr11:115158628..115158828 CCATGGAGACCGTTCGTAGT Chr11:115158773..115158792 59.99 55
upstream ENSMUSE00000368652 Chr11:115157852..115158018 ACAGAGTCCAAACGCTGGAG Chr11:115157880..115157899 60.44 55
upstream ENSMUSE00000409260 Chr11:115147432..115147612 AGTTCGCCAAATTCAACCAC Chr11:115147571..115147590 59.98 45

*** Putative Vector Insertion (Chr 11: 115147431 - 115158019) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000350148 Chr11:115146613..115146800 GGGTTCTTGAAGCCTGACAC Chr11:115146667..115146686 59.7 55
downstream ENSMUSE00000646271 Chr11:115145619..115145693 TCTTGTCCGGGGAGAACATA Chr11:115145638..115145657 60.45 50
downstream ENSMUSE00000646270 Chr11:115145530..115145568 GAGAGCCAAGGGAAGAGGTG Chr11:115145511..115145530 61.3 60
downstream ENSMUSE00000390428 Chr11:115145514..115145693 ATGTGGTCAGAGAGCCAAGG Chr11:115145502..115145521 60.26 55
downstream ENSMUSE00000331611 Chr11:115144681..115144969 GGAATCGAGCCAGGTATGAG Chr11:115144872..115144891 59.65 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGCTGATTCCTATGGTC Chr11:115158033..115158053 59.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGCTGATTCCTATGGTC Chr11:115158033..115158053 59.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044788