Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36459
Trapped Gene
Adam32 (ENSMUSG00000037437)
Vector Insertion
Chr 8: 25962648 - 25974018
Public Clones IST14257E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387505 (Chr8:25973861..25974017 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCCATGGAAAGAGCATCTA Chr8:25973994..25974013 60.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387505 (Chr8:25973861..25974017 -)
Downstram Exon
ENSMUSE00000684800 (Chr8:25962649..25962750 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCCATGGAAAGAGCATCTA Chr8:25973994..25974013 60.18 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000511384 Chr8:26059192..26059273 ATGCTGCACACACTGCTGCT Chr8:26059236..26059255 63.26 55
upstream ENSMUSE00000714616 Chr8:26059192..26059267 ATGCTGCACACACTGCTGCT Chr8:26059236..26059255 63.26 55
upstream ENSMUSE00000718304 Chr8:26059192..26059273 ATGCTGCACACACTGCTGCT Chr8:26059236..26059255 63.26 55
upstream ENSMUSE00000335046 Chr8:26048577..26048641 No primer for this exon
upstream ENSMUSE00000393886 Chr8:26034537..26034598 CACTGTGCACCTCCAGAAAA Chr8:26034538..26034557 59.87 50
upstream ENSMUSE00000408003 Chr8:26032732..26032807 No primer for this exon
upstream ENSMUSE00000353634 Chr8:26031760..26031836 CAAAGGCTACCCGAACTCAG Chr8:26031791..26031810 59.87 55
upstream ENSMUSE00000382993 Chr8:26030382..26030553 AGGGTTCCTGCAGTTTGAGA Chr8:26030534..26030553 59.84 50
upstream ENSMUSE00000255155 Chr8:26026760..26026828 No primer for this exon
upstream ENSMUSE00000255149 Chr8:26024791..26024862 ACTTGGGCTCTGACAGCAAT Chr8:26024836..26024855 59.87 50
upstream ENSMUSE00000255142 Chr8:26024431..26024597 TCGTGTTGTCCTCATTGGAG Chr8:26024553..26024572 59.68 50
upstream ENSMUSE00000255132 Chr8:26013275..26013356 AGCAACGTATCCTGGGAAGA Chr8:26013310..26013329 59.69 50
upstream ENSMUSE00000255126 Chr8:26011914..26012050 GGAGGCCTTTTCGGTTATTC Chr8:26012011..26012030 59.91 50
upstream ENSMUSE00000255116 Chr8:26008926..26009103 GTGACTGTGGCTCTGAAGCA Chr8:26008926..26008945 60.19 55
upstream ENSMUSE00000255108 Chr8:25996693..25996797 CCTCATCAACATGCTGCAAA Chr8:25996702..25996721 60.81 45
upstream ENSMUSE00000340723 Chr8:25994910..25995108 ACATCAATGTAGGCCGGAAA Chr8:25995075..25995094 60.33 45
upstream ENSMUSE00000386790 Chr8:25989193..25989301 ATGCTCCATTTGCCTGCTAT Chr8:25989273..25989292 59.7 45
upstream ENSMUSE00000343444 Chr8:25983044..25983233 CCTACCCGAATGCCTTACAA Chr8:25983180..25983199 59.95 50
upstream ENSMUSE00000383140 Chr8:25981158..25981241 TAAATGGCGTGTGCGTAGAA Chr8:25981215..25981234 60.27 45
upstream ENSMUSE00000347940 Chr8:25974819..25974924 GGCTACTCACCTCCCAACTG Chr8:25974869..25974888 59.72 60
upstream ENSMUSE00000387505 Chr8:25973861..25974017 GCCCATGGAAAGAGCATCTA Chr8:25973994..25974013 60.18 50
upstream ENSMUSE00000486334 Chr8:25962712..25962750 No primer for this exon
upstream ENSMUSE00000684800 Chr8:25962649..25962750 No primer for this exon

*** Putative Vector Insertion (Chr 8: 25962648 - 25974018) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000684799 Chr8:25962089..25962097 No primer for this exon
downstream ENSMUSE00000684804 Chr8:25948255..25948293 No primer for this exon
downstream ENSMUSE00000712522 Chr8:25948255..25948293 No primer for this exon
downstream ENSMUSE00000684803 Chr8:25946618..25946791 AGCTGTGACCAAGGGAAGAA Chr8:25946625..25946644 59.84 50
downstream ENSMUSE00000719508 Chr8:25946618..25946791 AGCTGTGACCAAGGGAAGAA Chr8:25946625..25946644 59.84 50
downstream ENSMUSE00000712485 Chr8:25946616..25946791 AGCTGTGACCAAGGGAAGAA Chr8:25946625..25946644 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTTGATCTAATCGCCTTGC Chr8:25973955..25973976 59.45 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTTCTTGATCCGTGACTGG Chr8:25973958..25973979 59.58 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037437