Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36499
Trapped Gene
Ncoa7 (ENSMUSG00000039697)
Vector Insertion
Chr 10: 30382099 - 30409679
Public Clones IST12463H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000430523 (Chr10:30409510..30409678 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCATCAAAGTGGGAAAG Chr10:30409611..30409630 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000430523 (Chr10:30409510..30409678 -)
Downstram Exon
ENSMUSE00000430520 (Chr10:30382100..30382247 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCATCAAAGTGGGAAAG Chr10:30409611..30409630 59.69 45 TCCTTGGCATCTTTCCCATA Chr10:30382160..30382179 60.4 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000576767 Chr10:30522635..30522744 No primer for this exon
upstream ENSMUSE00000457172 Chr10:30491526..30491646 GGAACAGAAGGAACGGAAAC Chr10:30491542..30491561 58.62 50
upstream ENSMUSE00000457151 Chr10:30442452..30442672 TCCGGGAAAGATGATGCTAA Chr10:30442586..30442605 60.54 45
upstream ENSMUSE00000457145 Chr10:30424407..30424486 CAGGGCACCATGGAATACAC Chr10:30424408..30424427 61.19 55
upstream ENSMUSE00000457142 Chr10:30421725..30421832 CCAGGACACCCTCAACTCTG Chr10:30421805..30421824 60.7 60
upstream ENSMUSE00000457139 Chr10:30417936..30418049 CACCCCTGGTGCTACTGTCT Chr10:30417974..30417993 60.17 60
upstream ENSMUSE00000457134 Chr10:30415874..30415999 AAACCCATCGAGAGGGTCTTA Chr10:30415952..30415972 59.95 47.62
upstream ENSMUSE00000457130 Chr10:30413875..30414059 GAAGATCAAAGACGCCTTGC Chr10:30413879..30413898 59.96 50
upstream ENSMUSE00000430526 Chr10:30410563..30411593 CAGGGGAACAACCAGTGAGT Chr10:30411322..30411341 60 55
upstream ENSMUSE00000430523 Chr10:30409510..30409678 TGTGCATCAAAGTGGGAAAG Chr10:30409611..30409630 59.69 45
upstream ENSMUSE00000430520 Chr10:30382100..30382247 TATGGGAAAGATGCCAAGGA Chr10:30382182..30382201 60.4 45

*** Putative Vector Insertion (Chr 10: 30382099 - 30409679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000615004 Chr10:30375443..30375517 AGGCCTGGCACAATAGAAAA Chr10:30375442..30375461 59.71 45
downstream ENSMUSE00000666505 Chr10:30375443..30375623 AGGCCTGGCACAATAGAAAA Chr10:30375442..30375461 59.71 45
downstream ENSMUSE00000386110 Chr10:30374117..30374248 GGGGCTGTAGGATAGGCAGT Chr10:30374130..30374149 60.48 60
downstream ENSMUSE00000342960 Chr10:30372742..30372894 CTTCAAGCTCGTTCCATGCT Chr10:30372789..30372808 60.54 50
downstream ENSMUSE00000318639 Chr10:30368251..30368346 TCGCCTGTGCCATAATAGTG Chr10:30368263..30368282 59.71 50
downstream ENSMUSE00000576772 Chr10:30367773..30367846 CCTCCACCACCAAGTTCTAAAG Chr10:30367751..30367772 60.03 50
downstream ENSMUSE00000471047 Chr10:30366133..30367457 GAGTTGCTGCGTCCATGATA Chr10:30367382..30367401 59.83 50
downstream ENSMUSE00000644318 Chr10:30366133..30367457 GAGTTGCTGCGTCCATGATA Chr10:30367382..30367401 59.83 50
downstream ENSMUSE00000666504 Chr10:30356342..30356365 AATGGCCAAGGTGAGAGATG Chr10:30356322..30356341 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAGGGTTGAGGATTGCTT Chr10:30382692..30382712 58.65 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCGTGACTGGGAAAAC Chr10:30382613..30382633 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039697