Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36514
Trapped Gene
Rftn1 (ENSMUSG00000039316)
Vector Insertion
Chr 17: 50246394 - 50308485
Public Clones IST13431C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313741 (Chr17:50308328..50308484 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGATGGGTTGCAGTTTGA Chr17:50308457..50308476 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313741 (Chr17:50308328..50308484 -)
Downstram Exon
ENSMUSE00000313718 (Chr17:50246395..50246581 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGATGGGTTGCAGTTTGA Chr17:50308457..50308476 59.69 45 GGTTTTCTTGACCAGGATGG Chr17:50246378..50246397 59.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000542136 Chr17:50329546..50329822 TCTGCATGGCACAAACTTTC Chr17:50329607..50329626 59.85 45
upstream ENSMUSE00000313741 Chr17:50308328..50308484 CAAGATGGGTTGCAGTTTGA Chr17:50308457..50308476 59.69 45
upstream ENSMUSE00000313718 Chr17:50246395..50246581 CCATCCTGGTCAAGAAAACC Chr17:50246400..50246419 59.38 50

*** Putative Vector Insertion (Chr 17: 50246394 - 50308485) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000694744 Chr17:50233501..50233657 TCTCAAGGAGCTGTGTGCTG Chr17:50233543..50233562 60.33 55
downstream ENSMUSE00000313696 Chr17:50225893..50226001 TAGCCTTCGTCGTGAAGCTC Chr17:50225947..50225966 60.68 55
downstream ENSMUSE00000694742 Chr17:50225893..50226001 TAGCCTTCGTCGTGAAGCTC Chr17:50225947..50225966 60.68 55
downstream ENSMUSE00000313669 Chr17:50194562..50194952 GGCACCACGCTAACAAACTT Chr17:50194884..50194903 60.18 50
downstream ENSMUSE00000694740 Chr17:50194562..50194952 GGCACCACGCTAACAAACTT Chr17:50194884..50194903 60.18 50
downstream ENSMUSE00000313650 Chr17:50186622..50186825 CTCACTGTCTGGCCGTTCTT Chr17:50186695..50186714 60.44 55
downstream ENSMUSE00000694739 Chr17:50186622..50186825 CTCACTGTCTGGCCGTTCTT Chr17:50186695..50186714 60.44 55
downstream ENSMUSE00000313635 Chr17:50176266..50176381 TAGCGTCATAGCCCTGTGTG Chr17:50176273..50176292 59.89 55
downstream ENSMUSE00000313604 Chr17:50143579..50143682 AGTATAGGCGTTGGCAGCAC Chr17:50143569..50143588 60.3 55
downstream ENSMUSE00000313576 Chr17:50141957..50142038 ATCTGCTTGGTGGACACGTT Chr17:50141990..50142009 60.58 50
downstream ENSMUSE00000313539 Chr17:50132632..50133806 GGTCAAGCCAAAGGGTAACA Chr17:50133366..50133385 59.97 50
downstream ENSMUSE00000694738 Chr17:50132585..50133806 GGTCAAGCCAAAGGGTAACA Chr17:50133366..50133385 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGTAAACATGGGGTGTGG Chr17:50305437..50305457 60.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACGTGACTGGGAAAAC Chr17:50305419..50305439 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039316