Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3653
Trapped Gene
Eif4e (ENSMUSG00000028156)
Vector Insertion
Chr 3: 138190279 - 138209284
Public Clones AB0180 (sanger) (sanger) CF0158 (sanger) (sanger) XF301 (baygenomics)
XK501 (baygenomics) 5SD001D02 (ggtc) D015G05 (ggtc) 5SD015G05 (ggtc)
3SD001D02 (ggtc) P130G02 (ggtc) 3SD015G05 (ggtc) IST10104D9 (tigm)
IST13220D8 (tigm) IST14565F10 (tigm) IST13601C6 (tigm) IST13220D10 (tigm)
IST14510G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669180 (Chr3:138190249..138190278 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTAAGATGGCGACTGTGGA Chr3:138190255..138190274 59.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669180 (Chr3:138190249..138190278 +)
Downstram Exon
ENSMUSE00000176798 (Chr3:138209285..138209391 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTAAGATGGCGACTGTGGA Chr3:138190255..138190274 59.39 50 CAGGTGGGGGATTAGTGGTA Chr3:138209318..138209337 59.67 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669180 Chr3:138190249..138190278 TCTAAGATGGCGACTGTGGA Chr3:138190255..138190274 59.39 50

*** Putative Vector Insertion (Chr 3: 138190279 - 138209284) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176798 Chr3:138209285..138209391 CAGGTGGGGGATTAGTGGTA Chr3:138209318..138209337 59.67 55
downstream ENSMUSE00000176794 Chr3:138210623..138210718 GCTTGCCAAGTTTTGCTTTT Chr3:138210673..138210692 59.52 40
downstream ENSMUSE00000176797 Chr3:138213227..138213290 AGTCACAGCCAGGCATTAAA Chr3:138213279..138213298 58.38 45
downstream ENSMUSE00000238571 Chr3:138213857..138213970 GATCGAGGTCACTCCGTCTC Chr3:138213956..138213975 59.8 60
downstream ENSMUSE00000176799 Chr3:138216546..138216685 TTCTCCAATAAGGCACAGCA Chr3:138216569..138216588 59.42 45
downstream ENSMUSE00000635611 Chr3:138218354..138219596 GTGCATGGGGAAGACACTCT Chr3:138219526..138219545 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTTTCCTTAATCGCCTTG Chr3:138208320..138208341 60.34 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCTACCGTGACTGGGAAA Chr3:138208323..138208343 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028156