Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36532
Trapped Gene
Zfp446 (ENSMUSG00000033961)
Vector Insertion
Chr 7: 13564996 - 13565262
Public Clones IST12625H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000287031 (Chr7:13564800..13564995 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTCCTCAGGGAGTCACCA Chr7:13564848..13564867 60.24 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000287031 (Chr7:13564800..13564995 +)
Downstram Exon
ENSMUSE00000677111 (Chr7:13565263..13565328 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTCCTCAGGGAGTCACCA Chr7:13564848..13564867 60.24 60 TGGAGACCGTTTCCTGATGT Chr7:13565305..13565324 60.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677109 Chr7:13563197..13563567 CGTAAGGAGGCTAACCCACA Chr7:13563204..13563223 60.12 55
upstream ENSMUSE00000715200 Chr7:13563197..13563461 CGTAAGGAGGCTAACCCACA Chr7:13563204..13563223 60.12 55
upstream ENSMUSE00000718429 Chr7:13563197..13563461 CGTAAGGAGGCTAACCCACA Chr7:13563204..13563223 60.12 55
upstream ENSMUSE00000677107 Chr7:13563587..13564727 CTGGGACACAGGTTCCAGTT Chr7:13563751..13563770 60 55
upstream ENSMUSE00000337043 Chr7:13564347..13564727 TACCCCACACCTATCCCTCA Chr7:13564403..13564422 60.19 55
upstream ENSMUSE00000677112 Chr7:13564347..13564727 TACCCCACACCTATCCCTCA Chr7:13564403..13564422 60.19 55
upstream ENSMUSE00000287031 Chr7:13564800..13564995 GAGTCCTCAGGGAGTCACCA Chr7:13564848..13564867 60.24 60

*** Putative Vector Insertion (Chr 7: 13564996 - 13565262) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000287025 Chr7:13565234..13565328 TGGAGACCGTTTCCTGATGT Chr7:13565305..13565324 60.51 50
downstream ENSMUSE00000677111 Chr7:13565263..13565328 TGGAGACCGTTTCCTGATGT Chr7:13565305..13565324 60.51 50
downstream ENSMUSE00000287019 Chr7:13567195..13567276 GGGACACCACTGTGTCGTACT Chr7:13567275..13567295 59.94 57.14
downstream ENSMUSE00000677104 Chr7:13567195..13568745 CACTCCACGCATGTGTATCC Chr7:13567873..13567892 59.99 55
downstream ENSMUSE00000404710 Chr7:13567468..13569648 CACTCCACGCATGTGTATCC Chr7:13567873..13567892 59.99 55
downstream ENSMUSE00000677106 Chr7:13567468..13569664 CACTCCACGCATGTGTATCC Chr7:13567873..13567892 59.99 55
downstream ENSMUSE00000677108 Chr7:13567468..13568745 CACTCCACGCATGTGTATCC Chr7:13567873..13567892 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000033961