Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36543
Trapped Gene
Zfp60 (ENSMUSG00000037640)
Vector Insertion
Chr 7: 28533186 - 28536709
Public Clones IST10074A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000563275 (Chr7:28533187..28536708 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCCTTTAATCGTCGCTCA Chr7:28533802..28533821 59.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000563275 (Chr7:28533187..28536708 +)
Downstram Exon
ENSMUSE00000676346 (Chr7:28533187..28538721 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCCTTTAATCGTCGCTCA Chr7:28533802..28533821 59.98 45 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676347 Chr7:28516408..28516489 TCGGGTCTTTCTGGTCTGAG Chr7:28516436..28516455 60.38 55
upstream ENSMUSE00000676350 Chr7:28516428..28516683 GTTTAGGGACGGTGCTGTGT Chr7:28516556..28516575 60.03 55
upstream ENSMUSE00000597846 Chr7:28521955..28522007 CCTGAAGAAGAATGGCCAAC Chr7:28521964..28521983 59.67 50
upstream ENSMUSE00000713205 Chr7:28521955..28522007 CCTGAAGAAGAATGGCCAAC Chr7:28521964..28521983 59.67 50
upstream ENSMUSE00000597848 Chr7:28523322..28523448 AGGGATGTGGCTGTTGACTT Chr7:28523337..28523356 59.58 50
upstream ENSMUSE00000597847 Chr7:28525976..28526074 CAGGAGAAAGAGCCCTGGAT Chr7:28526020..28526039 60.72 55

*** Putative Vector Insertion (Chr 7: 28533186 - 28536709) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000563275 Chr7:28533187..28536708 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50
downstream ENSMUSE00000676346 Chr7:28533187..28538721 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCATGTTAATCGCCTTGCAG Chr7:28536230..28536251 60.11 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGTCGTGACTGGGAAAA Chr7:28536231..28536251 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037640