Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36552
Trapped Gene
4632419K20Rik (ENSMUSG00000044465)
Vector Insertion
Chr 7: 112527124 - 112529733
Public Clones IST10857C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506337 (Chr7:112529594..112529732 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCCTGCTCTGCTATCCA Chr7:112529684..112529703 60.49 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506337 (Chr7:112529594..112529732 -)
Downstram Exon
ENSMUSE00000384683 (Chr7:112527125..112527643 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCCTGCTCTGCTATCCA Chr7:112529684..112529703 60.49 55 AGTAATTCCCCCAAGGATGG Chr7:112527588..112527607 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436926 Chr7:112548398..112548525 CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50
upstream ENSMUSE00000716976 Chr7:112548398..112548546 CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50
upstream ENSMUSE00000719956 Chr7:112548398..112548522 CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50
upstream ENSMUSE00000712218 Chr7:112540091..112540181 GCTGAGCCACATTCTGTGAA Chr7:112540134..112540153 59.99 50
upstream ENSMUSE00000436924 Chr7:112538535..112538866 AGACCGGATGAAGCAGATTG Chr7:112538754..112538773 60.22 50
upstream ENSMUSE00000716956 Chr7:112538535..112538866 AGACCGGATGAAGCAGATTG Chr7:112538754..112538773 60.22 50
upstream ENSMUSE00000503564 Chr7:112537768..112538406 AGGCCTGGTGCTACTTCTCA Chr7:112538004..112538023 60.01 55
upstream ENSMUSE00000289443 Chr7:112537293..112537451 TGCCTCGAAAGATTGAGGTT Chr7:112537395..112537414 59.81 45
upstream ENSMUSE00000289435 Chr7:112537070..112537156 TTCACAATGGTTTCCTGGTG Chr7:112537097..112537116 59.39 45
upstream ENSMUSE00000289431 Chr7:112536698..112536865 CTTCCTGCGATTCCTGTTGT Chr7:112536763..112536782 60.26 50
upstream ENSMUSE00000289425 Chr7:112533857..112533936 CAGGACCCTTCTGAACCTCA Chr7:112533891..112533910 60.23 55
upstream ENSMUSE00000289417 Chr7:112533502..112533665 TGTGCGTGATGTGGATCTTT Chr7:112533601..112533620 60.12 45
upstream ENSMUSE00000716496 Chr7:112533460..112533665 TGTGCGTGATGTGGATCTTT Chr7:112533601..112533620 60.12 45
upstream ENSMUSE00000720002 Chr7:112532889..112533086 ACCATCTCGTCTGGCTCTGT Chr7:112533009..112533028 59.87 55
upstream ENSMUSE00000289404 Chr7:112532295..112533086 GAGCCAAGAAGGTTCGTCTG Chr7:112532569..112532588 59.99 55
upstream ENSMUSE00000671188 Chr7:112532290..112533086 GAGCCAAGAAGGTTCGTCTG Chr7:112532569..112532588 59.99 55
upstream ENSMUSE00000289393 Chr7:112529913..112530091 TTTCCTGCTCAACACCAACA Chr7:112529948..112529967 60.28 45
upstream ENSMUSE00000436436 Chr7:112529594..112529756 CTTCCCTGCTCTGCTATCCA Chr7:112529684..112529703 60.49 55
upstream ENSMUSE00000506337 Chr7:112529594..112529732 CTTCCCTGCTCTGCTATCCA Chr7:112529684..112529703 60.49 55
upstream ENSMUSE00000715253 Chr7:112527126..112527643 CCATCCTTGGGGGAATTACT Chr7:112527610..112527629 60.01 50
upstream ENSMUSE00000384683 Chr7:112527125..112527643 CCATCCTTGGGGGAATTACT Chr7:112527610..112527629 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGACTTCCCTGCTCTGCTA Chr7:112529686..112529706 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGACTTCCCTGCTCTGCTA Chr7:112529686..112529706 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044465