Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36562
Trapped Gene
Cdkl2 (ENSMUSG00000029403)
Vector Insertion
Chr 5: 92468263 - 92471699
Public Clones IST10923F1 (tigm) IST12291B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694459 (Chr5:92471213..92471698 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGAGGTCGTTGCCTTGAC Chr5:92471460..92471479 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694459 (Chr5:92471213..92471698 -)
Downstram Exon
ENSMUSE00000188537 (Chr5:92468264..92468462 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGAGGTCGTTGCCTTGAC Chr5:92471460..92471479 60.31 55 CCATTCCGTAACTCCCCTCT Chr5:92468358..92468377 60.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495542 Chr5:92471825..92472032 GGCAGAAAGGTCCCTACAAA Chr5:92471882..92471901 59.17 50
upstream ENSMUSE00000597280 Chr5:92471825..92472044 GGCAGAAAGGTCCCTACAAA Chr5:92471882..92471901 59.17 50
upstream ENSMUSE00000694459 Chr5:92471213..92471698 AGTGAGGTCGTTGCCTTGAC Chr5:92471460..92471479 60.31 55
upstream ENSMUSE00000694468 Chr5:92471213..92471722 AGTGAGGTCGTTGCCTTGAC Chr5:92471460..92471479 60.31 55
upstream ENSMUSE00000188537 Chr5:92468264..92468462 GAGGGGAGTTACGGAATGGT Chr5:92468379..92468398 60.19 55
upstream ENSMUSE00000709299 Chr5:92468264..92468462 GAGGGGAGTTACGGAATGGT Chr5:92468379..92468398 60.19 55

*** Putative Vector Insertion (Chr 5: 92468263 - 92471699) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188536 Chr5:92466194..92466388 GTGACTGTGGCAAAATCCAA Chr5:92466175..92466194 59.55 45
downstream ENSMUSE00000597281 Chr5:92462605..92462783 TACTTGACGTCACCGACCAG Chr5:92462589..92462608 59.74 55
downstream ENSMUSE00000188533 Chr5:92462150..92462262 CTGCCCCATAAGCATTTCAA Chr5:92462186..92462205 60.96 45
downstream ENSMUSE00000188531 Chr5:92460009..92460154 TCTTTGACCTCAGGCAACCT Chr5:92460054..92460073 59.84 50
downstream ENSMUSE00000323321 Chr5:92453962..92454050 GCCTTTTGTCTGGGTCAATG Chr5:92453998..92454017 60.49 50
downstream ENSMUSE00000188521 Chr5:92451129..92451258 TTCTTCACCTAAGGCATCGTC Chr5:92451128..92451148 59.33 47.62
downstream ENSMUSE00000188524 Chr5:92449044..92449339 CCTTAATTTTGGGGTCAGCA Chr5:92449290..92449309 59.93 45
downstream ENSMUSE00000188527 Chr5:92448405..92448498 GGAGGAGGCTGATTTGGTTT Chr5:92448417..92448436 60.44 50
downstream ENSMUSE00000188520 Chr5:92446408..92446531 CTTGTTTGCCTGAAGGAGGT Chr5:92446474..92446493 59.33 50
downstream ENSMUSE00000188526 Chr5:92446148..92446254 CTGGACACGTGCAGATCAAT Chr5:92446142..92446161 59.71 50
downstream ENSMUSE00000323297 Chr5:92437991..92438079 CATCTGACAGGGGTGATCCT Chr5:92438033..92438052 59.92 55
downstream ENSMUSE00000694457 Chr5:92436849..92437160 GGGCACTTGTTCAATCTTCC Chr5:92436969..92436988 59.53 50
downstream ENSMUSE00000694465 Chr5:92436830..92437160 GGGCACTTGTTCAATCTTCC Chr5:92436969..92436988 59.53 50
downstream ENSMUSE00000542479 Chr5:92435183..92437160 AAGGCTTTGGGGTAAGGCTA Chr5:92436177..92436196 60.09 50
downstream ENSMUSE00000442164 Chr5:92435101..92437160 AAGGCTTTGGGGTAAGGCTA Chr5:92436177..92436196 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATTGTAATCGCCTTGCAG Chr5:92468634..92468654 61.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTGCGTGACTGGGAAAAC Chr5:92468633..92468653 61.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029403