Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36581
Trapped Gene
Mlstd1 (ENSMUSG00000030303)
Vector Insertion
Chr 6: 147996035 - 148087057
Public Clones IST10440E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000420422 (Chr6:147995938..147996034 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGAGTGCCTCCTTCATCT Chr6:147995964..147995983 59.56 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000420422 (Chr6:147995938..147996034 +)
Downstram Exon
ENSMUSE00000720361 (Chr6:148087058..148087283 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGAGTGCCTCCTTCATCT Chr6:147995964..147995983 59.56 55 ACTTGGGTCTCACGAGGATG Chr6:148087239..148087258 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688472 Chr6:147995781..147996034 CTCGAGTGCCTCCTTCATCT Chr6:147995964..147995983 59.56 55
upstream ENSMUSE00000420422 Chr6:147995938..147996034 CTCGAGTGCCTCCTTCATCT Chr6:147995964..147995983 59.56 55

*** Putative Vector Insertion (Chr 6: 147996035 - 148087057) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197233 Chr6:148087058..148087283 ACTTGGGTCTCACGAGGATG Chr6:148087239..148087258 60.11 55
downstream ENSMUSE00000720361 Chr6:148087058..148087283 ACTTGGGTCTCACGAGGATG Chr6:148087239..148087258 60.11 55
downstream ENSMUSE00000197246 Chr6:148094536..148094711 AGTCACGCTGGTTGAGGTCT Chr6:148094620..148094639 59.91 55
downstream ENSMUSE00000197242 Chr6:148099112..148099291 GATGAAGGCTTCCAGCTTTG Chr6:148099196..148099215 59.96 50
downstream ENSMUSE00000197231 Chr6:148105885..148106062 CACATTCAGGTTTCCGCTCT Chr6:148106014..148106033 60.26 50
downstream ENSMUSE00000197237 Chr6:148106434..148106478 No primer for this exon
downstream ENSMUSE00000197240 Chr6:148107441..148107559 TGGGAGTCGCTTTTATGGAC Chr6:148107483..148107502 60.07 50
downstream ENSMUSE00000197227 Chr6:148108189..148108256 No primer for this exon
downstream ENSMUSE00000197224 Chr6:148114096..148114267 TGGCCTTCTGAAAGCACTCT Chr6:148114157..148114176 60.13 50
downstream ENSMUSE00000197229 Chr6:148121920..148122049 TCTCCGTGTTGTTTGTGCTC Chr6:148122017..148122036 59.88 50
downstream ENSMUSE00000197225 Chr6:148122423..148122550 ATACCGGCCAGATCCTCTTT Chr6:148122526..148122545 59.92 50
downstream ENSMUSE00000378084 Chr6:148123568..148125371 AGTGTGGAGTGGTGGTGTCA Chr6:148124047..148124066 60.04 55
downstream ENSMUSE00000688477 Chr6:148123568..148123670 GAGGCGCCAGATGATAAGAA Chr6:148123628..148123647 60.32 50
downstream ENSMUSE00000688475 Chr6:148129508..148131282 TGCTGTCGTTTCAGACTTGG Chr6:148130454..148130473 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr6:148053085..148053105 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTAGGCTAGGGCGTGACTG Chr6:148050074..148050094 59.9 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030303