Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36594
Trapped Gene
Tyms (ENSMUSG00000025747)
Vector Insertion
Chr 5: 30385366 - 30388580
Public Clones (ggtc) (ggtc) IST10569B12 (tigm) IST12818F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000152897 (Chr5:30388508..30388579 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCACACTTTGGGAGATGC Chr5:30388548..30388567 60.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000152897 (Chr5:30388508..30388579 -)
Downstram Exon
ENSMUSE00000363414 (Chr5:30385367..30387673 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCACACTTTGGGAGATGC Chr5:30388548..30388567 60.52 55 TGAAGGACTTTGTGGGTTCC Chr5:30386733..30386752 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000276060 Chr5:30399901..30400121 GACTGCTCCGTTATGCTGGT Chr5:30400080..30400099 60.28 55
upstream ENSMUSE00000152886 Chr5:30398174..30398247 TCTGCTCACAACCAAACGAG Chr5:30398218..30398237 60.03 50
upstream ENSMUSE00000152892 Chr5:30395006..30395180 GCCCAGTTTATGGTTTCCAA Chr5:30395046..30395065 59.8 45
upstream ENSMUSE00000152888 Chr5:30390625..30390726 CGGGACAAGGAGTAGACCAG Chr5:30390701..30390720 59.72 60
upstream ENSMUSE00000152895 Chr5:30389776..30389951 CTTGCCAGCTTTACCAGAGG Chr5:30389863..30389882 60.01 55
upstream ENSMUSE00000152897 Chr5:30388508..30388579 GTCCACACTTTGGGAGATGC Chr5:30388548..30388567 60.52 55
upstream ENSMUSE00000363414 Chr5:30385367..30387673 GGAACCCACAAAGTCCTTCA Chr5:30386755..30386774 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAGGTGATTTTGTCCAC Chr5:30388560..30388580 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACACTTTGGGAGATGCACA Chr5:30388543..30388563 60.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025747