Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36597
Trapped Gene
Trpc5 (ENSMUSG00000041710)
Vector Insertion
Chr X: 140958006 - 141122724
Public Clones IST12233F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653257 (ChrX:141122342..141122723 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAAGAGTTTCGGGCACTG ChrX:141122634..141122653 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653257 (ChrX:141122342..141122723 -)
Downstram Exon
ENSMUSE00000372386 (ChrX:140958007..140958405 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAAGAGTTTCGGGCACTG ChrX:141122634..141122653 59.99 55 TGGCGTAGAGTAATGCATCG ChrX:140958053..140958072 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653257 ChrX:141122342..141122723 GAGAAGAGTTTCGGGCACTG ChrX:141122634..141122653 59.99 55
upstream ENSMUSE00000372386 ChrX:140958007..140958405 TGTGGAGAAGGGGGACTATG ChrX:140958249..140958268 59.92 55

*** Putative Vector Insertion (Chr X: 140958006 - 141122724) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254103 ChrX:140915503..140916024 ATTTGATTGCCACCTTCAGC ChrX:140915495..140915514 60.08 45
downstream ENSMUSE00000544888 ChrX:140862028..140862364 AGCCAGGAGAAGCATGAAGA ChrX:140862091..140862110 60.1 50
downstream ENSMUSE00000254086 ChrX:140859807..140859946 TGTATTCCGTGAATCCACCA ChrX:140859871..140859890 59.77 45
downstream ENSMUSE00000254080 ChrX:140854074..140854396 CCCTTGGACGAGAACCATTA ChrX:140854353..140854372 59.93 50
downstream ENSMUSE00000544877 ChrX:140846155..140846350 GCGACTGAAGGGTTTCAAAG ChrX:140846306..140846325 59.85 50
downstream ENSMUSE00000254065 ChrX:140822692..140822895 GTTGTGCCTCCTTCGTCTTC ChrX:140822685..140822704 59.85 55
downstream ENSMUSE00000254062 ChrX:140822396..140822437 No primer for this exon
downstream ENSMUSE00000254055 ChrX:140820437..140820526 TTGCAGCCACATATCTCTTGA ChrX:140820465..140820485 59.44 42.86
downstream ENSMUSE00000370405 ChrX:140816214..140817736 TAATGCTGTTCATCGGACCA ChrX:140816470..140816489 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC ChrX:141095656..141095676 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACATTCGTGACTGGGAAAA ChrX:141095659..141095679 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041710