Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36600
Trapped Gene
Cldn18 (ENSMUSG00000032473)
Vector Insertion
Chr 9: 99591217 - 99596596
Public Clones IST14261A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219921 (Chr9:99596485..99596595 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATTGGGGGAGTGATGATGT Chr9:99596522..99596541 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219921 (Chr9:99596485..99596595 -)
Downstram Exon
ENSMUSE00000324921 (Chr9:99591218..99593313 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATTGGGGGAGTGATGATGT Chr9:99596522..99596541 59.59 50 AGTCCGACCAGGGACTTTCT Chr9:99591366..99591385 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693514 Chr9:99617415..99617634 CATTGCAGCCACTTGTATGG Chr9:99617553..99617572 60.13 50
upstream ENSMUSE00000488794 Chr9:99610148..99610434 CCAGTATGAAGGGCTCTGGA Chr9:99610217..99610236 60.21 55
upstream ENSMUSE00000219922 Chr9:99599228..99599392 CGGTATCCTCGTGTCCATCT Chr9:99599318..99599337 59.95 55
upstream ENSMUSE00000219924 Chr9:99598490..99598616 GCATCTGTGCAATCATTGGT Chr9:99598597..99598616 59.53 45
upstream ENSMUSE00000219921 Chr9:99596485..99596595 GATTGGGGGAGTGATGATGT Chr9:99596522..99596541 59.59 50
upstream ENSMUSE00000324921 Chr9:99591218..99593313 CATAGATGCAGCCCCTGTTT Chr9:99592162..99592181 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTTTGGTGCAGCTCTGTT Chr9:99596570..99596590 59.91 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTTTGGTGCAGCTCTGTT Chr9:99596570..99596590 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032473