Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36601
Trapped Gene
Zfp791 (ENSMUSG00000074194)
Vector Insertion
Chr 8: 87637405 - 87643769
Public Clones IST10172B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681246 (Chr8:87643534..87643768 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGTCTCACCAGAACAACT Chr8:87643728..87643747 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681246 (Chr8:87643534..87643768 -)
Downstram Exon
ENSMUSE00000635478 (Chr8:87637406..87637532 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGTCTCACCAGAACAACT Chr8:87643728..87643747 60.15 55 GGACGCAGTAGATCCCACTC Chr8:87637446..87637465 59.69 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681248 Chr8:87646962..87646994 No primer for this exon
upstream ENSMUSE00000681246 Chr8:87643534..87643768 CGGGTCTCACCAGAACAACT Chr8:87643728..87643747 60.15 55
upstream ENSMUSE00000635478 Chr8:87637406..87637532 TGGGATCTACTGCGTCCTGT Chr8:87637465..87637484 60.68 55

*** Putative Vector Insertion (Chr 8: 87637405 - 87643769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635477 Chr8:87636109..87636169 No primer for this exon
downstream ENSMUSE00000635475 Chr8:87633067..87634941 GCAGTACGTGAGGCAGATGA Chr8:87633971..87633990 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCATCTGGAAACCGAGAA Chr8:87640788..87640808 61.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGACGTGACTGGGAAAA Chr8:87640704..87640724 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074194