Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36607
Trapped Gene
BX005465.14 (ENSMUSG00000081702)
Vector Insertion
Chr X: 150565500 - 150568515
Public Clones IST14257H9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720260 (ChrX:150568486..150568514 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720260 (ChrX:150568486..150568514 -)
Downstram Exon
ENSMUSE00000719666 (ChrX:150565501..150566185 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCCTTCACAGGACGCTTTAG ChrX:150565516..150565535 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720260 ChrX:150568486..150568514 No primer for this exon
upstream ENSMUSE00000719666 ChrX:150565501..150566185 GTCCTGTGAAGGCCAATGAT ChrX:150565531..150565550 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC ChrX:150568481..150568501 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCTTCTAGATGCGTGAAC ChrX:150568497..150568517 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000081702