Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36618
Trapped Gene
Gm364 (ENSMUSG00000079584)
Vector Insertion
Chr X: 54676554 - 54686385
Public Clones IST11884C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700375 (ChrX:54676442..54676553 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGAAGACCACCTGACTTGC ChrX:54676455..54676475 59.72 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700375 (ChrX:54676442..54676553 +)
Downstram Exon
ENSMUSE00000700374 (ChrX:54686386..54686465 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGAAGACCACCTGACTTGC ChrX:54676455..54676475 59.72 52.38 TCCGAGGACCACTCAGTAGC ChrX:54686417..54686436 60.41 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700381 ChrX:54662353..54662550 GGCCACTACCTGTGATGCTT ChrX:54662466..54662485 60.14 55
upstream ENSMUSE00000700380 ChrX:54667437..54667504 CCTCAATTCAGGTGTATGCTGA ChrX:54667438..54667459 60.13 45.46
upstream ENSMUSE00000700379 ChrX:54668944..54669037 No primer for this exon
upstream ENSMUSE00000700378 ChrX:54670836..54670963 TGCTCCAGACAATGAAGATGA ChrX:54670886..54670906 59.38 42.86
upstream ENSMUSE00000700377 ChrX:54671326..54671455 TTTTAATGCCCCAAGTGACC ChrX:54671410..54671429 59.8 45
upstream ENSMUSE00000700376 ChrX:54675020..54675147 TCCAGAGTCGATCCCAAAAG ChrX:54675128..54675147 60.19 50
upstream ENSMUSE00000700375 ChrX:54676442..54676553 GATGAAGACCACCTGACTTGC ChrX:54676455..54676475 59.72 52.38

*** Putative Vector Insertion (Chr X: 54676554 - 54686385) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700374 ChrX:54686386..54686465 TCCGAGGACCACTCAGTAGC ChrX:54686417..54686436 60.41 60
downstream ENSMUSE00000700373 ChrX:54689587..54689695 CCACCAGTCCACACAAGAAA ChrX:54689636..54689655 59.56 50
downstream ENSMUSE00000700372 ChrX:54690561..54690693 TCCTTGACCAAGAAGGATGG ChrX:54690662..54690681 60.04 50
downstream ENSMUSE00000700370 ChrX:54692741..54692860 GGCAGACATGTATCCAGCAG ChrX:54692850..54692869 59.27 55
downstream ENSMUSE00000700369 ChrX:54693065..54693122 No primer for this exon
downstream ENSMUSE00000700368 ChrX:54716258..54716417 TACAGTGCAAAGAGGCTTGC ChrX:54716362..54716381 59.22 50
downstream ENSMUSE00000700366 ChrX:54717443..54717591 ATGCTCATGTTTTGGTGCAT ChrX:54717481..54717500 59.01 40
downstream ENSMUSE00000700365 ChrX:54721595..54721706 CAGCCGAAAATAGCATAGCA ChrX:54721700..54721719 59.08 45
downstream ENSMUSE00000700364 ChrX:54725531..54725702 GTCAAAAAGGCTCTCCACCA ChrX:54725565..54725584 60.23 50
downstream ENSMUSE00000700362 ChrX:54741762..54741829 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTAATCGCCTTGCAGCAC ChrX:54676602..54676622 61.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAATAATTTTCGTGACTGG ChrX:54685592..54685614 58.99 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079584