Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3664
Trapped Gene
Tnpo2 (ENSMUSG00000031691)
Vector Insertion
Chr 8: 87560877 - 87562233
Public Clones AT0055 (sanger) (sanger) CA0237 (sanger) Ex331 (baygenomics) P117G09 (ggtc)
D187D10 (ggtc) (ggtc) D119C07 (ggtc) (ggtc) IST15058E7 (tigm)
Private Clones OST436876 (lexicon) OST42543 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606588 (Chr8:87560814..87560876 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGAAGCTGCAGCACTTAG Chr8:87560830..87560850 60.85 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606588 (Chr8:87560814..87560876 +)
Downstram Exon
ENSMUSE00000480800 (Chr8:87562234..87562388 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGAAGCTGCAGCACTTAG Chr8:87560830..87560850 60.85 52.38 AGTAGCTGTGTTGGGCGACT Chr8:87562373..87562392 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606588 Chr8:87560814..87560876 TGGAGAAGCTGCAGCACTTAG Chr8:87560830..87560850 60.85 52.38

*** Putative Vector Insertion (Chr 8: 87560877 - 87562233) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480800 Chr8:87562234..87562388 AGTAGCTGTGTTGGGCGACT Chr8:87562373..87562392 59.94 55
downstream ENSMUSE00000581298 Chr8:87564361..87564436 TCTGATTTGAGTCTGGTCAGGA Chr8:87564435..87564456 59.84 45.46
downstream ENSMUSE00000581297 Chr8:87564513..87564662 CGCCAATGTTGTTGAGACAC Chr8:87564635..87564654 60.16 50
downstream ENSMUSE00000476299 Chr8:87568311..87568417 CTGAGTTGAGCAGGTTGCAC Chr8:87568400..87568419 59.62 55
downstream ENSMUSE00000477305 Chr8:87568501..87568634 AGCTCCGAGGAGTCTTCACA Chr8:87568550..87568569 60.13 55
downstream ENSMUSE00000478044 Chr8:87568725..87568806 TGATGAACTGGTTCACACAGG Chr8:87568761..87568781 59.58 47.62
downstream ENSMUSE00000479084 Chr8:87568882..87569004 CTGTCAATTCGCACTTCCAA Chr8:87568976..87568995 59.84 45
downstream ENSMUSE00000487811 Chr8:87569097..87569215 GCTAGCGTCAGCCAGAACTC Chr8:87569173..87569192 60.31 60
downstream ENSMUSE00000487867 Chr8:87571020..87571080 CTTCATCCCATTCACGAGGA Chr8:87571053..87571072 61 50
downstream ENSMUSE00000489631 Chr8:87571189..87571354 ACTGTGCGTGACTTGTGGAA Chr8:87571268..87571287 60.36 50
downstream ENSMUSE00000490673 Chr8:87571482..87571634 CCACTCAGGGTGGAATAGGA Chr8:87571591..87571610 59.92 55
downstream ENSMUSE00000581296 Chr8:87573835..87574060 CTTGAGGTGCATGTCAGGTG Chr8:87573995..87574014 60.31 55
downstream ENSMUSE00000486009 Chr8:87574258..87574429 CTCCTCCAGGGTAGCAAATG Chr8:87574282..87574301 59.69 55
downstream ENSMUSE00000495246 Chr8:87575437..87575523 CCTTGTCTTCGTCCTTGAGC Chr8:87575506..87575525 59.99 55
downstream ENSMUSE00000514347 Chr8:87575598..87575705 TGGTAGACAGGCTCGCAGTA Chr8:87575665..87575684 59.62 55
downstream ENSMUSE00000515344 Chr8:87575788..87575946 CCAACGCAACAATCATGAAG Chr8:87575854..87575873 60.11 45
downstream ENSMUSE00000494411 Chr8:87577358..87577445 ACAGGGCTTGACGTGGATAA Chr8:87577444..87577463 60.52 50
downstream ENSMUSE00000581295 Chr8:87577655..87577753 CCAGGTAGCATTGTTGCAGA Chr8:87577728..87577747 59.86 50
downstream ENSMUSE00000496264 Chr8:87578225..87578320 TGGGCCTGTTAATGATCTCC Chr8:87578293..87578312 59.89 50
downstream ENSMUSE00000502489 Chr8:87578591..87578696 CTGGAATGGCAGAGGGACTC Chr8:87578623..87578642 62.13 60
downstream ENSMUSE00000492590 Chr8:87578901..87579000 TTGTCCCGGATGTTCCTAAG Chr8:87578933..87578952 59.93 50
downstream ENSMUSE00000505196 Chr8:87579078..87579152 AACATGTCCCGAAGGTCATC Chr8:87579148..87579167 59.79 50
downstream ENSMUSE00000501702 Chr8:87579239..87579366 CTCCCCAACTTGGTCTTTGA Chr8:87579274..87579293 60.08 50
downstream ENSMUSE00000581293 Chr8:87579450..87581479 GTACCAATCTGGCGTGGTCT Chr8:87580587..87580606 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGCTGCAGCACTTAGGC Chr8:87560834..87560854 59.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGCTGCAGCACTTAGGC Chr8:87560834..87560854 59.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031691