Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36646
Trapped Gene
Afap1l2 (ENSMUSG00000025083)
Vector Insertion
Chr 19: 57039286 - 57076794
Public Clones IST10914E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688396 (Chr19:57076740..57076793 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCTGGTGGTGCAGAGAAG Chr19:57076760..57076779 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688396 (Chr19:57076740..57076793 -)
Downstram Exon
ENSMUSE00000714181 (Chr19:57039287..57039349 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCTGGTGGTGCAGAGAAG Chr19:57076760..57076779 60.02 55 CGGAGATACATCTTGCCACA Chr19:57039271..57039290 59.67 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712232 Chr19:57082641..57082700 No primer for this exon
upstream ENSMUSE00000716839 Chr19:57082641..57082718 No primer for this exon
upstream ENSMUSE00000718217 Chr19:57082641..57082688 No primer for this exon
upstream ENSMUSE00000719686 Chr19:57082641..57082700 No primer for this exon
upstream ENSMUSE00000688346 Chr19:57076740..57076793 TGTCTGGTGGTGCAGAGAAG Chr19:57076760..57076779 60.02 55
upstream ENSMUSE00000688396 Chr19:57076740..57076793 TGTCTGGTGGTGCAGAGAAG Chr19:57076760..57076779 60.02 55
upstream ENSMUSE00000714181 Chr19:57039287..57039349 No primer for this exon

*** Putative Vector Insertion (Chr 19: 57039286 - 57076794) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000707948 Chr19:57038320..57038362 No primer for this exon
downstream ENSMUSE00000688348 Chr19:57025642..57025654 No primer for this exon
downstream ENSMUSE00000444241 Chr19:57024628..57024756 GGAAGTCGTCCAGCTCTGTC Chr19:57024699..57024718 59.99 60
downstream ENSMUSE00000688394 Chr19:57024628..57024756 GGAAGTCGTCCAGCTCTGTC Chr19:57024699..57024718 59.99 60
downstream ENSMUSE00000617340 Chr19:57019195..57019269 GTTCCCCGTTGACTGACACT Chr19:57019197..57019216 60.01 55
downstream ENSMUSE00000688390 Chr19:57019195..57019269 GTTCCCCGTTGACTGACACT Chr19:57019197..57019216 60.01 55
downstream ENSMUSE00000719863 Chr19:57019195..57019269 GTTCCCCGTTGACTGACACT Chr19:57019197..57019216 60.01 55
downstream ENSMUSE00000617339 Chr19:57017935..57018029 AGGTCTGGAAGGCTCTTCTG Chr19:57017929..57017948 58.62 55
downstream ENSMUSE00000617338 Chr19:57011725..57011815 CTCAGGGGACTCGATCTTTG Chr19:57011746..57011765 59.8 55
downstream ENSMUSE00000617337 Chr19:57004546..57004751 CCTTTGCTGTTCTCGTCCTC Chr19:57004669..57004688 59.99 55
downstream ENSMUSE00000617336 Chr19:57002739..57002918 CGTTCATCGGTGTGATCTTG Chr19:57002773..57002792 60.11 50
downstream ENSMUSE00000617335 Chr19:56999557..56999646 TGGGCATCTGGTGTGTACTG Chr19:56999554..56999573 60.59 55
downstream ENSMUSE00000617334 Chr19:56998023..56998107 TACTCCGCTGCTGACAGGTA Chr19:56998048..56998067 59.62 55
downstream ENSMUSE00000617333 Chr19:56997425..56997529 CTTCCTGCCCAGGTTCATAA Chr19:56997449..56997468 60.07 50
downstream ENSMUSE00000617332 Chr19:56994867..56995078 TGGCTGTCTCTAACGAAGCA Chr19:56994993..56995012 59.74 50
downstream ENSMUSE00000617331 Chr19:56992472..56992617 AGCTCTTCCGGGTCAGTCTT Chr19:56992516..56992535 60.39 55
downstream ENSMUSE00000617330 Chr19:56991616..56991727 GCCATCGATGTATGTGTTGG Chr19:56991660..56991679 59.81 50
downstream ENSMUSE00000617329 Chr19:56990814..56991062 GGACTTGACCGGTGTGAGAT Chr19:56990948..56990967 59.97 55
downstream ENSMUSE00000617328 Chr19:56990552..56990732 TCGGCCTGTAGCTTAACCAT Chr19:56990634..56990653 59.73 50
downstream ENSMUSE00000617327 Chr19:56990162..56990317 TCTGTCCGATTCTTCCCAAG Chr19:56990268..56990287 60.19 50
downstream ENSMUSE00000617326 Chr19:56988860..56989053 AGGTGCGTGGTATCCACAGT Chr19:56988857..56988876 60.45 55
downstream ENSMUSE00000617325 Chr19:56988615..56988743 AGAGTTGACTGGCGTGGAGT Chr19:56988665..56988684 59.91 55
downstream ENSMUSE00000715217 Chr19:56986851..56987898 GAAATGGGGCAGGTAACAGA Chr19:56986997..56987016 59.93 50
downstream ENSMUSE00000541488 Chr19:56986850..56987898 GAAATGGGGCAGGTAACAGA Chr19:56986997..56987016 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATAATCGCCTTGCAGCAC Chr19:57040726..57040746 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGAGCAAACGCTGCTGTTC Chr19:57043766..57043786 59.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025083