Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36651
Trapped Gene
Myo1f (ENSMUSG00000024300)
Vector Insertion
Chr 17: 33692802 - 33712735
Public Clones IST10107F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699210 (Chr17:33692664..33692801 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAACTAGGGCCAAGAGC Chr17:33692682..33692701 60.35 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699210 (Chr17:33692664..33692801 +)
Downstram Exon
ENSMUSE00000331991 (Chr17:33712736..33712873 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAACTAGGGCCAAGAGC Chr17:33692682..33692701 60.35 60 GCTTCACGTTGTGACTCTGC Chr17:33712781..33712800 59.63 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699210 Chr17:33692664..33692801 GAGGAACTAGGGCCAAGAGC Chr17:33692682..33692701 60.35 60

*** Putative Vector Insertion (Chr 17: 33692802 - 33712735) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331991 Chr17:33712736..33712873 GCTTCACGTTGTGACTCTGC Chr17:33712781..33712800 59.63 55
downstream ENSMUSE00000140680 Chr17:33713379..33713468 GTAGGGCATCTGCTTGAAGG Chr17:33713435..33713454 59.84 55
downstream ENSMUSE00000546776 Chr17:33713558..33713652 CGGTACATGTTGTCGGTGAG Chr17:33713613..33713632 60.03 55
downstream ENSMUSE00000400959 Chr17:33715038..33715125 CCACCAGACACCTTGGAGAT Chr17:33715112..33715131 59.96 55
downstream ENSMUSE00000546771 Chr17:33715205..33715294 TCAAGCAGTGGGTTTGACTG Chr17:33715248..33715267 59.87 50
downstream ENSMUSE00000546769 Chr17:33716812..33716943 GCTCTCCACCTCGACTGAAC Chr17:33716854..33716873 59.99 60
downstream ENSMUSE00000430762 Chr17:33717104..33717238 GTCATCAGTGCCTTCCACCT Chr17:33717217..33717236 60.12 55
downstream ENSMUSE00000430749 Chr17:33718903..33719035 CGGGCATAATTCCCTTCTTC Chr17:33719021..33719040 60.76 50
downstream ENSMUSE00000395069 Chr17:33719185..33719381 CTGTCCATCTTACGGCTGGT Chr17:33719266..33719285 60.13 55
downstream ENSMUSE00000140670 Chr17:33720630..33720710 ACGCCGATGCTGTATTCTTC Chr17:33720682..33720701 60.24 50
downstream ENSMUSE00000546764 Chr17:33720835..33720921 CCTTCAGCGTGAGCTCAATA Chr17:33720916..33720935 59.17 50
downstream ENSMUSE00000305523 Chr17:33722538..33722624 GCCCTCTTGCACATACTCCT Chr17:33722561..33722580 59.31 55
downstream ENSMUSE00000546729 Chr17:33723061..33723228 GCCTGCATAGTGATGGATGA Chr17:33723228..33723247 59.63 50
downstream ENSMUSE00000657679 Chr17:33725048..33725133 AGCACATCTCGATTCCTCTCA Chr17:33725096..33725116 59.97 47.62
downstream ENSMUSE00000657678 Chr17:33727773..33727854 CAGGAAAGAGCATCCGTAGG Chr17:33727801..33727820 59.83 55
downstream ENSMUSE00000546754 Chr17:33729866..33729972 AGTGGGGTGTGCACTTCTTC Chr17:33729917..33729936 60.16 55
downstream ENSMUSE00000372513 Chr17:33730966..33731064 CAGGTACTCCACCTGGTGCT Chr17:33730993..33731012 60.17 60
downstream ENSMUSE00000402427 Chr17:33731168..33731312 ATGTTGACAGCACGAAGCAG Chr17:33731257..33731276 60.06 50
downstream ENSMUSE00000140678 Chr17:33734886..33735000 CCAGGCTTTCTGGATAGTGC Chr17:33734957..33734976 59.84 55
downstream ENSMUSE00000546748 Chr17:33735088..33735257 ACTGAGTCGGCAAAGTCCAC Chr17:33735235..33735254 60.31 55
downstream ENSMUSE00000140687 Chr17:33737996..33738141 CGCACTAGACCCTTCTCTGG Chr17:33738090..33738109 60.01 60
downstream ENSMUSE00000140672 Chr17:33738604..33738750 CTCTTCAAAACGCTTGCACA Chr17:33738715..33738734 60.17 45
downstream ENSMUSE00000140684 Chr17:33738887..33739035 CTTTCTTCACCCGGAACTGT Chr17:33738912..33738931 59.18 50
downstream ENSMUSE00000140681 Chr17:33739471..33739554 No primer for this exon
downstream ENSMUSE00000699190 Chr17:33739471..33739535 No primer for this exon
downstream ENSMUSE00000699188 Chr17:33739538..33739554 No primer for this exon
downstream ENSMUSE00000699187 Chr17:33739673..33739695 No primer for this exon
downstream ENSMUSE00000140662 Chr17:33741202..33741397 GGTACCCCATTTCGATTCAA Chr17:33741226..33741245 59.62 45
downstream ENSMUSE00000699185 Chr17:33741202..33741254 GGTGGTACCCCATTTCGATT Chr17:33741229..33741248 60.81 50
downstream ENSMUSE00000699181 Chr17:33741272..33741316 No primer for this exon
downstream ENSMUSE00000699180 Chr17:33741318..33741397 CCCTGGTCAGGCACATTAAG Chr17:33741391..33741410 60.51 55
downstream ENSMUSE00000140665 Chr17:33741495..33741664 No primer for this exon
downstream ENSMUSE00000546724 Chr17:33744244..33744703 CTGGGAGGTAGGTTTTGCAG Chr17:33744572..33744591 59.73 55
downstream ENSMUSE00000707337 Chr17:33744244..33744320 CTTCCACCAGCCAGAAGAGT Chr17:33744266..33744285 59.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGCAGGTGAGCTGTCAAA Chr17:33692779..33692799 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCACGTGACTGGGAAAAC Chr17:33692848..33692868 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024300