Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36681
Trapped Gene
Leng4 (ENSMUSG00000035596)
Vector Insertion
Chr 7: 3637275 - 3640285
Public Clones IST12103G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601553 (Chr7:3640125..3640284 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAGGTCCCCTCTTTGATG Chr7:3640168..3640187 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601553 (Chr7:3640125..3640284 -)
Downstram Exon
ENSMUSE00000308015 (Chr7:3637276..3637636 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAGGTCCCCTCTTTGATG Chr7:3640168..3640187 59.65 55 GAAGAGATGGGAGGACAGCA Chr7:3637472..3637491 60.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601557 Chr7:3644343..3644575 CCTAGAAAGATCGCGACAGG Chr7:3644549..3644568 59.97 55
upstream ENSMUSE00000722165 Chr7:3644343..3644650 CCTAGAAAGATCGCGACAGG Chr7:3644549..3644568 59.97 55
upstream ENSMUSE00000601556 Chr7:3643642..3643720 ATGACACCCGAAGAATGGAC Chr7:3643698..3643717 59.79 50
upstream ENSMUSE00000718697 Chr7:3643642..3643720 ATGACACCCGAAGAATGGAC Chr7:3643698..3643717 59.79 50
upstream ENSMUSE00000601555 Chr7:3643408..3643537 CTGGGGCTCACCTTATTCAC Chr7:3643480..3643499 59.55 55
upstream ENSMUSE00000601554 Chr7:3642864..3642990 CTTGCCTGGACCTTCTCCTA Chr7:3642952..3642971 59.42 55
upstream ENSMUSE00000601553 Chr7:3640125..3640284 CTGAGGTCCCCTCTTTGATG Chr7:3640168..3640187 59.65 55
upstream ENSMUSE00000308015 Chr7:3637276..3637636 CCGCCTCTTCTACATGATCC Chr7:3637424..3637443 59.65 55

*** Putative Vector Insertion (Chr 7: 3637275 - 3640285) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308009 Chr7:3635411..3635587 CAAAACGTAGGAGCGGAAAG Chr7:3635391..3635410 59.88 50
downstream ENSMUSE00000710608 Chr7:3635279..3635587 CAAAACGTAGGAGCGGAAAG Chr7:3635391..3635410 59.88 50
downstream ENSMUSE00000520186 Chr7:3629392..3630451 CTCCAAATAGCCCTCAGCAG Chr7:3630321..3630340 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr7:3637217..3637237 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAATCACTTGCCTTCCTCT Chr7:3640295..3640315 59.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035596