Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36682
Trapped Gene
Osbpl6 (ENSMUSG00000042359)
Vector Insertion
Chr 2: 76337480 - 76351973
Public Clones IST14149E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000421360 (Chr2:76337314..76337479 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACGAGCTAAAGGCATCCA Chr2:76337393..76337412 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000421360 (Chr2:76337314..76337479 +)
Downstram Exon
ENSMUSE00000689810 (Chr2:76351974..76352213 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACGAGCTAAAGGCATCCA Chr2:76337393..76337412 59.98 50 AAGCTCAGGTTCAGGCAAGA Chr2:76352116..76352135 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601502 Chr2:76244595..76244746 No primer for this exon
upstream ENSMUSE00000421360 Chr2:76337314..76337479 AGACGAGCTAAAGGCATCCA Chr2:76337393..76337412 59.98 50

*** Putative Vector Insertion (Chr 2: 76337480 - 76351973) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689810 Chr2:76351974..76352213 AAGCTCAGGTTCAGGCAAGA Chr2:76352116..76352135 60.13 50
downstream ENSMUSE00000710315 Chr2:76361946..76362201 CTTCTATGGGTCGGAGTGGA Chr2:76362164..76362183 60.06 55
downstream ENSMUSE00000710705 Chr2:76361946..76362201 CTTCTATGGGTCGGAGTGGA Chr2:76362164..76362183 60.06 55
downstream ENSMUSE00000714347 Chr2:76361946..76362201 CTTCTATGGGTCGGAGTGGA Chr2:76362164..76362183 60.06 55
downstream ENSMUSE00000356981 Chr2:76378161..76378253 CTAGCAACTGCCGACTGACA Chr2:76378230..76378249 60.2 55
downstream ENSMUSE00000689807 Chr2:76378161..76378253 CTAGCAACTGCCGACTGACA Chr2:76378230..76378249 60.2 55
downstream ENSMUSE00000328607 Chr2:76384035..76384157 CATAAATCCCTCGTGCCTGT Chr2:76384121..76384140 59.96 50
downstream ENSMUSE00000689806 Chr2:76384035..76384157 CATAAATCCCTCGTGCCTGT Chr2:76384121..76384140 59.96 50
downstream ENSMUSE00000328367 Chr2:76386376..76386429 AAGTGGCGCCTTGGAATACT Chr2:76386429..76386448 61.01 50
downstream ENSMUSE00000689805 Chr2:76386376..76386429 AAGTGGCGCCTTGGAATACT Chr2:76386429..76386448 61.01 50
downstream ENSMUSE00000566127 Chr2:76387497..76387610 CTATGCTCCCGTGCACTTTT Chr2:76387530..76387549 60.27 50
downstream ENSMUSE00000689804 Chr2:76387497..76387610 CTATGCTCCCGTGCACTTTT Chr2:76387530..76387549 60.27 50
downstream ENSMUSE00000566126 Chr2:76387718..76387888 GGCGACCTCACAATTTCATT Chr2:76387806..76387825 59.94 45
downstream ENSMUSE00000689803 Chr2:76387718..76387888 GGCGACCTCACAATTTCATT Chr2:76387806..76387825 59.94 45
downstream ENSMUSE00000644353 Chr2:76390175..76390307 GGAGGCTGTTACTGCATGGT Chr2:76390232..76390251 60.14 55
downstream ENSMUSE00000689802 Chr2:76390175..76390307 GGAGGCTGTTACTGCATGGT Chr2:76390232..76390251 60.14 55
downstream ENSMUSE00000328566 Chr2:76393071..76393174 TGACTGGCAGTGTGCAAGAT Chr2:76393093..76393112 60.47 50
downstream ENSMUSE00000328555 Chr2:76393947..76394039 CTTGTGACCCGCTTGTCTTT Chr2:76393993..76394012 60.29 50
downstream ENSMUSE00000420956 Chr2:76398243..76398317 GCCGAGTTGTGTTGAACTGG Chr2:76398285..76398304 61.69 55
downstream ENSMUSE00000328546 Chr2:76402841..76403006 GAGGGGTCTGGAACTCAATG Chr2:76402928..76402947 59.51 55
downstream ENSMUSE00000328537 Chr2:76406166..76406299 TGGCCTTTGTTGTGATCTTG Chr2:76406262..76406281 59.69 45
downstream ENSMUSE00000601500 Chr2:76407077..76407100 No primer for this exon
downstream ENSMUSE00000328527 Chr2:76415069..76415176 TCATCGGGGCTAGGGATAAT Chr2:76415178..76415197 60.62 50
downstream ENSMUSE00000328517 Chr2:76417230..76417367 GACACGGATTCTGACATGGA Chr2:76417315..76417334 59.48 50
downstream ENSMUSE00000328511 Chr2:76422518..76422605 CTCACGTCGCTGATGTAGGA Chr2:76422555..76422574 60.01 55
downstream ENSMUSE00000328505 Chr2:76423073..76423326 TTGCCAATGTTGTTCCTCAA Chr2:76423196..76423215 60.09 40
downstream ENSMUSE00000328498 Chr2:76424171..76424308 TGCTCGGAAGTAGGTGGAAC Chr2:76424227..76424246 60.26 55
downstream ENSMUSE00000328489 Chr2:76424772..76424835 ATGGGTGGATGATGGCTAAC Chr2:76424794..76424813 59.63 50
downstream ENSMUSE00000328480 Chr2:76426609..76426687 GTTCCGACAGGCAGGATTTC Chr2:76426669..76426688 61.94 55
downstream ENSMUSE00000328470 Chr2:76428371..76428515 CCGTAGTGCTCGATCCATCT Chr2:76428457..76428476 60.24 55
downstream ENSMUSE00000328463 Chr2:76429841..76429985 ACCCCGCAGTAGAGTCCTTC Chr2:76429956..76429975 60.65 60
downstream ENSMUSE00000328454 Chr2:76431397..76431523 CCAACTCATTGAGCTCCACA Chr2:76431468..76431487 59.83 50
downstream ENSMUSE00000328444 Chr2:76432821..76432943 ATGTAGCGTCTTCGCGATCT Chr2:76432907..76432926 60.01 50
downstream ENSMUSE00000644349 Chr2:76433321..76433369 GCCAAATCTGAGCAGACACA Chr2:76433347..76433366 59.99 50
downstream ENSMUSE00000411351 Chr2:76433931..76438704 AGGTTCCACATCTCCGTGAC Chr2:76437905..76437924 59.97 55
downstream ENSMUSE00000566122 Chr2:76433931..76438700 AGGTTCCACATCTCCGTGAC Chr2:76437905..76437924 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACTTGCTAATCGCCTTGC Chr2:76343523..76343543 59.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTTCTTCATGATGCTCAAA Chr2:76343499..76343521 60.4 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042359