Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36687
Trapped Gene
AL844147.9 (ENSMUSG00000081712)
Vector Insertion
Chr 11: 30428980 - 30429257
Public Clones IST14743A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709457 (Chr11:30428295..30428979 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGAGATGGTTGTTGGTT Chr11:30428512..30428531 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709457 (Chr11:30428295..30428979 +)
Downstram Exon
ENSMUSE00000717294 (Chr11:30429258..30429401 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGAGATGGTTGTTGGTT Chr11:30428512..30428531 59.97 50 TGATGTTTGGGATCCTGCTT Chr11:30429322..30429341 60.46 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709457 Chr11:30428295..30428979 GCCAGAGATGGTTGTTGGTT Chr11:30428512..30428531 59.97 50

*** Putative Vector Insertion (Chr 11: 30428980 - 30429257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000717294 Chr11:30429258..30429401 TGATGTTTGGGATCCTGCTT Chr11:30429322..30429341 60.46 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:30429031..30429051 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000081712