Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36691
Trapped Gene
Rnf43 (ENSMUSG00000034177)
Vector Insertion
Chr 11: 87478370 - 87513398
Public Clones IST10897H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713076 (Chr11:87477775..87478369 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCATTGATGCAGCTGGTA Chr11:87478096..87478115 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713076 (Chr11:87477775..87478369 +)
Downstram Exon
ENSMUSE00000586313 (Chr11:87513399..87513625 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCATTGATGCAGCTGGTA Chr11:87478096..87478115 59.98 50 CACCCAGAGCCGATATGAAT Chr11:87513585..87513604 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713076 Chr11:87477775..87478369 GAGCATTGATGCAGCTGGTA Chr11:87478096..87478115 59.98 50
upstream ENSMUSE00000267661 Chr11:87478118..87478369 GTGGAGTCCGAAAGATCAGC Chr11:87478223..87478242 59.81 55

*** Putative Vector Insertion (Chr 11: 87478370 - 87513398) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000586313 Chr11:87513399..87513625 CACCCAGAGCCGATATGAAT Chr11:87513585..87513604 59.92 50
downstream ENSMUSE00000577799 Chr11:87531880..87532002 GCTCAAGGTTGTCGTCATCA Chr11:87531931..87531950 59.84 50
downstream ENSMUSE00000586318 Chr11:87531880..87532002 GCTCAAGGTTGTCGTCATCA Chr11:87531931..87531950 59.84 50
downstream ENSMUSE00000267654 Chr11:87540652..87540726 GAGTACTGCGTTGGCTCCTC Chr11:87540693..87540712 60.02 60
downstream ENSMUSE00000586317 Chr11:87540652..87540726 GAGTACTGCGTTGGCTCCTC Chr11:87540693..87540712 60.02 60
downstream ENSMUSE00000267651 Chr11:87540838..87540969 CACACATAGGCCTTCCGATT Chr11:87540944..87540963 59.96 50
downstream ENSMUSE00000710943 Chr11:87540838..87540899 GCAGCATCACTACCCCAGAT Chr11:87540899..87540918 60.1 55
downstream ENSMUSE00000586316 Chr11:87541528..87541632 CAGGAGGATCCACACGTCAT Chr11:87541557..87541576 60.96 55
downstream ENSMUSE00000586315 Chr11:87542902..87543063 TCTAGACAGATGGCACACACG Chr11:87543046..87543066 59.91 52.38
downstream ENSMUSE00000267636 Chr11:87543634..87543736 CACACGTTCGATGAAACTCG Chr11:87543682..87543701 60.3 50
downstream ENSMUSE00000351547 Chr11:87544529..87545887 AAGTAACCGCTGCGTTCTGT Chr11:87544952..87544971 59.94 50
downstream ENSMUSE00000404562 Chr11:87547658..87549040 GCAGACCCACGAGGTTACAT Chr11:87548661..87548680 60 55
downstream ENSMUSE00000714177 Chr11:87548778..87549041 AGGATCCCATGTCCATTTTG Chr11:87548890..87548909 59.6 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTAATCGCCTTGCAGCAC Chr11:87493418..87493438 61.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTTGAAACGGCCAACTC Chr11:87493354..87493374 59.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034177