Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36709
Trapped Gene
Gmfb (ENSMUSG00000062014)
Vector Insertion
Chr 14: 47437060 - 47441888
Public Clones IST14586D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689112 (Chr14:47441776..47441887 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCTTAAAGGGGCCCAAGA Chr14:47441817..47441836 59.9 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689112 (Chr14:47441776..47441887 -)
Downstram Exon
ENSMUSE00000514325 (Chr14:47437061..47437157 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCTTAAAGGGGCCCAAGA Chr14:47441817..47441836 59.9 45 AGCAACATCACAAACCACCA Chr14:47437106..47437125 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689097 Chr14:47441776..47441917 ATTCTTAAAGGGGCCCAAGA Chr14:47441817..47441836 59.9 45
upstream ENSMUSE00000689112 Chr14:47441776..47441887 ATTCTTAAAGGGGCCCAAGA Chr14:47441817..47441836 59.9 45
upstream ENSMUSE00000514325 Chr14:47437061..47437157 GGTGGTTTGTGATGTTGCTG Chr14:47437127..47437146 60.01 50

*** Putative Vector Insertion (Chr 14: 47437060 - 47441888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000515334 Chr14:47435853..47435902 AGGCGTTCATCCTTGTCAAT Chr14:47435856..47435875 59.56 45
downstream ENSMUSE00000512512 Chr14:47435274..47435323 No primer for this exon
downstream ENSMUSE00000521044 Chr14:47434580..47434662 ATAAAGCAGAGCGGGTACGA Chr14:47434575..47434594 59.87 50
downstream ENSMUSE00000689106 Chr14:47434580..47434665 ATAAAGCAGAGCGGGTACGA Chr14:47434575..47434594 59.87 50
downstream ENSMUSE00000518307 Chr14:47433919..47433992 CTTGGTTAGCTCGGCAGTCT Chr14:47433897..47433916 59.64 55
downstream ENSMUSE00000649400 Chr14:47427824..47431498 CACTTGCAATTGCTTCCTGA Chr14:47429810..47429829 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr14:47441818..47441838 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAAACAGGAAGGGAGTTG Chr14:47441846..47441866 61.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062014