Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36717
Trapped Gene
Sec63 (ENSMUSG00000019802)
Vector Insertion
Chr 10: 42481695 - 42503247
Public Clones IST10601D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000295890 (Chr10:42481302..42481694 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTACGATGACAGCGGGAAC Chr10:42481590..42481609 60.14 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000295890 (Chr10:42481302..42481694 +)
Downstram Exon
ENSMUSE00000295879 (Chr10:42503248..42503347 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTACGATGACAGCGGGAAC Chr10:42481590..42481609 60.14 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000295890 Chr10:42481302..42481694 AGTACGATGACAGCGGGAAC Chr10:42481590..42481609 60.14 55

*** Putative Vector Insertion (Chr 10: 42481695 - 42503247) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295879 Chr10:42503248..42503347 No primer for this exon
downstream ENSMUSE00000098148 Chr10:42509106..42509220 TAAGAACAGTGCCCATCCTG Chr10:42509145..42509164 58.72 50
downstream ENSMUSE00000098156 Chr10:42510985..42511097 No primer for this exon
downstream ENSMUSE00000098164 Chr10:42514581..42514642 CTTCCCAATTTTTCCGAGAC Chr10:42514618..42514637 58.62 45
downstream ENSMUSE00000295855 Chr10:42516012..42516070 CTATCCAAGCTGGCAAAGCA Chr10:42516050..42516069 61.43 50
downstream ENSMUSE00000098167 Chr10:42517489..42517539 No primer for this exon
downstream ENSMUSE00000098161 Chr10:42518553..42518661 CGTATTGACCGATACCACCA Chr10:42518581..42518600 59.27 50
downstream ENSMUSE00000098155 Chr10:42521439..42521533 GGCCTGCTTGTGGAATCTTT Chr10:42521511..42521530 61.51 50
downstream ENSMUSE00000098153 Chr10:42521628..42521760 GCTGCCAATTTCCCTGATTA Chr10:42521651..42521670 60.04 45
downstream ENSMUSE00000098151 Chr10:42523696..42523788 ACCATTTCTTGAAGCAGAGCA Chr10:42523746..42523766 60.01 42.86
downstream ENSMUSE00000098157 Chr10:42524882..42525036 TATGAGGGAGCTGCAGAAGG Chr10:42524998..42525017 60.49 55
downstream ENSMUSE00000098158 Chr10:42526330..42526477 GGTCACATACGGGAAACTCC Chr10:42526461..42526480 59.26 55
downstream ENSMUSE00000098165 Chr10:42530649..42530731 TGCCTCGTCAACTTAACCAA Chr10:42530724..42530743 59.32 45
downstream ENSMUSE00000098168 Chr10:42532242..42532301 GCAGATGGACTGCTCCTTTT Chr10:42532274..42532293 59.43 50
downstream ENSMUSE00000098149 Chr10:42532471..42532644 TTTTGGATTTGGGCATTTTC Chr10:42532555..42532574 59.75 35
downstream ENSMUSE00000098152 Chr10:42534861..42535019 GCCCTTGTCAGAAATGTCGT Chr10:42534908..42534927 60.12 50
downstream ENSMUSE00000098163 Chr10:42536174..42536275 No primer for this exon
downstream ENSMUSE00000666418 Chr10:42537734..42537888 ATGTTCGGGATACCACTCCA Chr10:42537878..42537897 60.19 50
downstream ENSMUSE00000295767 Chr10:42543687..42543785 GCCACCACCACTCTTGTTTT Chr10:42543711..42543730 60.01 50
downstream ENSMUSE00000098160 Chr10:42547683..42547787 TGCGGGAAACTTCAGTTCTA Chr10:42547706..42547725 58.5 45
downstream ENSMUSE00000295749 Chr10:42548697..42552316 TGGTCCCGGAGTAACTTTTG Chr10:42549561..42549580 59.96 50
downstream ENSMUSE00000666417 Chr10:42548697..42549089 TCTATCGCTGTGTCCCACTG Chr10:42548761..42548780 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATACAGGCCAGTCCCAGAAA Chr10:42502702..42502722 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATACAGGCCAGTCCCAGAAA Chr10:42502702..42502722 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019802