Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36719
Trapped Gene
Atp7a (ENSMUSG00000033792)
Vector Insertion
Chr X: 103282154 - 103283676
Public Clones IST10601D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000281456 (ChrX:103281428..103282153 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGAAAGTACCGCCAGCTCT ChrX:103281869..103281888 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000281456 (ChrX:103281428..103282153 +)
Downstram Exon
ENSMUSE00000337195 (ChrX:103283677..103283856 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGAAAGTACCGCCAGCTCT ChrX:103281869..103281888 60.01 50 AAGCACAGGTCATCCCAGAG ChrX:103283817..103283836 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696136 ChrX:103222615..103222718 No primer for this exon
upstream ENSMUSE00000333467 ChrX:103222656..103222718 No primer for this exon
upstream ENSMUSE00000281475 ChrX:103265109..103265246 AAATGGAGCCAAGTGTGGAT ChrX:103265125..103265144 59.41 45
upstream ENSMUSE00000718084 ChrX:103265109..103265246 AAATGGAGCCAAGTGTGGAT ChrX:103265125..103265144 59.41 45
upstream ENSMUSE00000378424 ChrX:103280453..103280942 AGCTTGTGAAGAGCACAGCA ChrX:103280806..103280825 59.93 50
upstream ENSMUSE00000281456 ChrX:103281428..103282153 TTGAAAGTACCGCCAGCTCT ChrX:103281869..103281888 60.01 50

*** Putative Vector Insertion (Chr X: 103282154 - 103283676) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696147 ChrX:103283674..103283856 AGGGCAAAAGAGGTGTTTCC ChrX:103283739..103283758 60.48 50
downstream ENSMUSE00000337195 ChrX:103283677..103283856 AAGCACAGGTCATCCCAGAG ChrX:103283817..103283836 60.26 55
downstream ENSMUSE00000281433 ChrX:103287423..103287586 CACTCGGGGTTGGATAACAG ChrX:103287505..103287524 60.37 55
downstream ENSMUSE00000281421 ChrX:103290192..103290353 GGAAGCACACGTCATTCCTC ChrX:103290218..103290237 60.67 55
downstream ENSMUSE00000281413 ChrX:103292116..103292192 No primer for this exon
downstream ENSMUSE00000378036 ChrX:103292729..103292954 AGGATCTGACGCTCCAGAAA ChrX:103292902..103292921 59.95 50
downstream ENSMUSE00000386154 ChrX:103294125..103294358 GAGTAGGCAAATGCGATGGT ChrX:103294237..103294256 60.1 50
downstream ENSMUSE00000281384 ChrX:103295866..103295957 No primer for this exon
downstream ENSMUSE00000281379 ChrX:103297199..103297326 GGGACTCGTCCACCATAGAA ChrX:103297320..103297339 59.93 55
downstream ENSMUSE00000281373 ChrX:103297686..103297840 TTGCTCGGATGAGGAGAGAT ChrX:103297775..103297794 59.91 50
downstream ENSMUSE00000281369 ChrX:103298051..103298185 GCCACTGAGTTTGTCTGCAA ChrX:103298089..103298108 60.03 50
downstream ENSMUSE00000281362 ChrX:103300486..103300680 ACAGGGACATGCGATACACA ChrX:103300578..103300597 59.99 50
downstream ENSMUSE00000281357 ChrX:103302523..103302705 TACTTTCTGCAGTCCCCACA ChrX:103302661..103302680 59.29 50
downstream ENSMUSE00000281350 ChrX:103305100..103305316 No primer for this exon
downstream ENSMUSE00000281343 ChrX:103310429..103310575 ATCCATTCCCGGTTACCAAT ChrX:103310483..103310502 60.26 45
downstream ENSMUSE00000281335 ChrX:103313591..103313733 GCAATAGCAATCAAGCCACA ChrX:103313621..103313640 59.84 45
downstream ENSMUSE00000281327 ChrX:103315574..103315777 CAGCTGCTTCAATGGCTACA ChrX:103315763..103315782 60.16 50
downstream ENSMUSE00000394198 ChrX:103316929..103317046 ACTTGCCACAACATCCAGAA ChrX:103316958..103316977 59.14 45
downstream ENSMUSE00000281307 ChrX:103318682..103318784 GATCCCATCCAGGGTTGTAA ChrX:103318730..103318749 59.6 50
downstream ENSMUSE00000281295 ChrX:103319678..103320069 CAGAAGCGAGTGCTTGTCAG ChrX:103319918..103319937 59.92 55
downstream ENSMUSE00000696135 ChrX:103319678..103320256 CAGAAGCGAGTGCTTGTCAG ChrX:103319918..103319937 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGAGAAGCAATTGAAGACA ChrX:103282111..103282131 59.15 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTTGCCAGGTAATCATCA ChrX:103282145..103282165 61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033792