Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36723
Trapped Gene
AK122209 (ENSMUSG00000031976)
Vector Insertion
Chr 8: 126549133 - 126551758
Public Clones IST11260A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000605661 (Chr8:126548956..126549132 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCAGTCATTGGTTGCATTT Chr8:126548975..126548994 60.9 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000605661 (Chr8:126548956..126549132 +)
Downstram Exon
ENSMUSE00000215385 (Chr8:126551759..126555089 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCAGTCATTGGTTGCATTT Chr8:126548975..126548994 60.9 45 AACACCCCTGACACCTGAAG Chr8:126554469..126554488 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678121 Chr8:126545408..126545707 ATGCGGACACCAGTCCTAAC Chr8:126545484..126545503 60 55
upstream ENSMUSE00000605662 Chr8:126547360..126547498 TGCTTGGATTTCCCATCAGT Chr8:126547456..126547475 60.46 45
upstream ENSMUSE00000605661 Chr8:126548956..126549132 GGCAGTCATTGGTTGCATTT Chr8:126548975..126548994 60.9 45

*** Putative Vector Insertion (Chr 8: 126549133 - 126551758) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215385 Chr8:126551759..126555089 AACACCCCTGACACCTGAAG Chr8:126554469..126554488 60 55
downstream ENSMUSE00000284614 Chr8:126558928..126559088 GTTGTCCCAGCCTCAAACAT Chr8:126559015..126559034 59.97 50
downstream ENSMUSE00000215384 Chr8:126560536..126560646 TCCGTTGAGTGGACATTTGA Chr8:126560595..126560614 60.09 45
downstream ENSMUSE00000215388 Chr8:126562061..126562303 TGACATGGTGAGGGTTGCTA Chr8:126562187..126562206 60.11 50
downstream ENSMUSE00000215390 Chr8:126565066..126565153 GCCGTCCTTCATGCATAACT Chr8:126565144..126565163 60.1 50
downstream ENSMUSE00000215387 Chr8:126568979..126569118 TGCAGACTCAAGGACCACTG Chr8:126569019..126569038 60.02 55
downstream ENSMUSE00000408080 Chr8:126571009..126572404 GTTCCCCAGCACCACTAGAA Chr8:126572028..126572047 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTTGGTTAATCGCCTTGC Chr8:126549176..126549196 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCTATGTGCGTCTTGGTC Chr8:126549165..126549185 59.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031976