Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36726
Trapped Gene
Sctr (ENSMUSG00000026387)
Vector Insertion
Chr 1: 121933016 - 121940027
Public Clones IST14570E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000659610 (Chr1:121932912..121933015 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCAACATGAATGGCTCCT Chr1:121932982..121933001 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000659610 (Chr1:121932912..121933015 +)
Downstram Exon
ENSMUSE00000659609 (Chr1:121940028..121940125 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCAACATGAATGGCTCCT Chr1:121932982..121933001 59.93 50 TGGCCAAGGAGGAACTGTAG Chr1:121940091..121940110 60.25 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659614 Chr1:121903555..121903908 ACAAAGGGGATCAACAGTGG Chr1:121903807..121903826 59.82 50
upstream ENSMUSE00000706912 Chr1:121903834..121903908 TGTCACTGCTTCTGCTGTGG Chr1:121903859..121903878 61.24 55
upstream ENSMUSE00000659613 Chr1:121918735..121918849 GAGCTCTGCCCAGATTGTGT Chr1:121918739..121918758 60.42 55
upstream ENSMUSE00000659612 Chr1:121919043..121919087 CCTTCGTACACGGTTCATCA Chr1:121919066..121919085 59.57 50
upstream ENSMUSE00000659611 Chr1:121928141..121928248 GAAGTGCCATGTCCGAAGTT Chr1:121928203..121928222 60.12 50
upstream ENSMUSE00000659610 Chr1:121932912..121933015 GGTCAACATGAATGGCTCCT Chr1:121932982..121933001 59.93 50

*** Putative Vector Insertion (Chr 1: 121933016 - 121940027) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000659609 Chr1:121940028..121940125 TGGCCAAGGAGGAACTGTAG Chr1:121940091..121940110 60.25 55
downstream ENSMUSE00000659608 Chr1:121941208..121941340 AGAGTACGGCGTCCTTGATG Chr1:121941305..121941324 60.28 55
downstream ENSMUSE00000659607 Chr1:121943236..121943389 AGATCATGACCAGCTTGCAG Chr1:121943263..121943282 58.99 50
downstream ENSMUSE00000383581 Chr1:121950251..121950311 AGCAACAAAAATGGCTGGAG Chr1:121950276..121950295 60.25 45
downstream ENSMUSE00000158633 Chr1:121950849..121950918 GGAAGCGTTGGAGTTGATGT Chr1:121950879..121950898 60.12 50
downstream ENSMUSE00000659606 Chr1:121950849..121950891 GGAAGCGTTGGAGTTGATGT Chr1:121950879..121950898 60.12 50
downstream ENSMUSE00000659605 Chr1:121950894..121950918 ACGATGGACAGAATCACAGG Chr1:121950920..121950939 58.51 50
downstream ENSMUSE00000158631 Chr1:121951962..121952053 No primer for this exon
downstream ENSMUSE00000659604 Chr1:121951962..121952014 No primer for this exon
downstream ENSMUSE00000158634 Chr1:121952971..121953097 CAGGGCCAATTCAAAGAACA Chr1:121953088..121953107 61 45
downstream ENSMUSE00000659600 Chr1:121958471..121958512 TCACCATTGAGGAAGCAGTAAA Chr1:121958512..121958533 59.75 40.91
downstream ENSMUSE00000659599 Chr1:121959695..121959859 GAACTCTTGGAGGTGCCACT Chr1:121959742..121959761 59.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGTGGGGTCAACATGAAT Chr1:121932976..121932996 60.63 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGTGGGGTCAACATGAAT Chr1:121932976..121932996 60.63 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026387