Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36747
Trapped Gene
Ctnna3 (ENSMUSG00000060843)
Vector Insertion
Chr 10: 62892928 - 62920257
Public Clones IST11677F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666234 (Chr10:62892846..62892927 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCGAGCGACCTCCTGATAG Chr10:62892908..62892927 59.97 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666234 (Chr10:62892846..62892927 +)
Downstram Exon
ENSMUSE00000666231 (Chr10:62920258..62920412 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCGAGCGACCTCCTGATAG Chr10:62892908..62892927 59.97 60 CTTTGGGTTCAGCTTTTGGA Chr10:62920386..62920405 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666234 Chr10:62892846..62892927 GTCGAGCGACCTCCTGATAG Chr10:62892908..62892927 59.97 60

*** Putative Vector Insertion (Chr 10: 62892928 - 62920257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666231 Chr10:62920258..62920412 CTTTGGGTTCAGCTTTTGGA Chr10:62920386..62920405 60.22 45
downstream ENSMUSE00000666233 Chr10:62966780..62966883 TTCAGGGTTATTGGCGTTTC Chr10:62966816..62966835 59.94 45
downstream ENSMUSE00000503639 Chr10:62966785..62966883 TTCAGGGTTATTGGCGTTTC Chr10:62966816..62966835 59.94 45
downstream ENSMUSE00000505914 Chr10:63000269..63000461 TTCCTCCACGGAAGCTAGAA Chr10:63000364..63000383 59.95 50
downstream ENSMUSE00000463264 Chr10:63029552..63029718 CTCCCTTTTCGGGAGGTAAC Chr10:63029619..63029638 59.93 55
downstream ENSMUSE00000465036 Chr10:63044692..63044811 GAGGTCGGACTTGTTGGAAA Chr10:63044745..63044764 60.09 50
downstream ENSMUSE00000464563 Chr10:63282970..63283233 AACATCGGAATGTTCCAAGC Chr10:63283086..63283105 59.94 45
downstream ENSMUSE00000475444 Chr10:63315370..63315573 TCACTGTGAGTGGGTTCAGG Chr10:63315403..63315422 59.71 55
downstream ENSMUSE00000461468 Chr10:63713446..63713526 GTCTGCGGAGGTCTCTTGTC Chr10:63713527..63713546 59.99 60
downstream ENSMUSE00000514746 Chr10:63723561..63723713 AGCTTCAATGAGGACCAGGA Chr10:63723641..63723660 59.8 50
downstream ENSMUSE00000518886 Chr10:63871939..63872031 GTGATTGGCTGCAATTCTGA Chr10:63872013..63872032 59.81 45
downstream ENSMUSE00000517836 Chr10:63950210..63950366 AGTCGTCAATGCTGGTGATG Chr10:63950354..63950373 59.71 50
downstream ENSMUSE00000467799 Chr10:64048708..64048908 CTATCCATTTCACCCGCAAC Chr10:64048849..64048868 60.33 50
downstream ENSMUSE00000515728 Chr10:64138513..64138664 CATCAAGCGCAGTCAGAGAG Chr10:64138590..64138609 59.88 55
downstream ENSMUSE00000476819 Chr10:64297326..64297418 TCTGAATGCTGGTGTGGCTA Chr10:64297401..64297420 60.41 50
downstream ENSMUSE00000479058 Chr10:64335909..64336090 CCAGCTTGCTCTTCACCTTC Chr10:64335996..64336015 60.13 55
downstream ENSMUSE00000478041 Chr10:64408667..64408772 AATCTGCCGAGCAAGAACAT Chr10:64408766..64408785 59.84 45
downstream ENSMUSE00000487262 Chr10:64422518..64422652 CCCCCAGATTTTGGATCTCT Chr10:64422635..64422654 60.26 50
downstream ENSMUSE00000489051 Chr10:64465294..64465690 GAACTCTGGATGCGGATGAT Chr10:64465409..64465428 60.04 50
downstream ENSMUSE00000666230 Chr10:64465294..64466415 GAACTCTGGATGCGGATGAT Chr10:64465409..64465428 60.04 50
downstream ENSMUSE00000666232 Chr10:64465294..64465713 GAACTCTGGATGCGGATGAT Chr10:64465409..64465428 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCCTGATAGGTGTGTGGA Chr10:62892918..62892938 58.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGGTCGTGACTGGGAAAAC Chr10:62904973..62904994 58.04 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060843