Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3676
Trapped Gene
Rab11fip3 (ENSMUSG00000037098)
Vector Insertion
Chr 17: 26158806 - 26161319
Public Clones XT0193 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610803 (Chr17:26161320..26161411 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGATGAGTTTGACGACTT Chr17:26161333..26161352 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610803 (Chr17:26161320..26161411 -)
Downstram Exon
ENSMUSE00000717929 (Chr17:26158633..26158805 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGATGAGTTTGACGACTT Chr17:26161333..26161352 60.26 50 TTTCTCATCATGCGATCCTG Chr17:26158689..26158708 59.76 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708271 Chr17:26204527..26205806 GTGCCACTTAGCCAAAGAGC Chr17:26205387..26205406 60.02 55
upstream ENSMUSE00000708731 Chr17:26204527..26205806 GTGCCACTTAGCCAAAGAGC Chr17:26205387..26205406 60.02 55
upstream ENSMUSE00000711568 Chr17:26204527..26206354 CGCCTTTCGTATCATCCCTA Chr17:26206142..26206161 60.05 50
upstream ENSMUSE00000721026 Chr17:26204527..26206122 GTGCCACTTAGCCAAAGAGC Chr17:26205387..26205406 60.02 55
upstream ENSMUSE00000437147 Chr17:26173534..26173627 TTGGCGTAATCAGCTTTGAA Chr17:26173571..26173590 59.44 40
upstream ENSMUSE00000610805 Chr17:26173534..26173627 TTGGCGTAATCAGCTTTGAA Chr17:26173571..26173590 59.44 40
upstream ENSMUSE00000466592 Chr17:26161320..26161411 GCCGATGAGTTTGACGACTT Chr17:26161333..26161352 60.26 50
upstream ENSMUSE00000610803 Chr17:26161320..26161411 GCCGATGAGTTTGACGACTT Chr17:26161333..26161352 60.26 50

*** Putative Vector Insertion (Chr 17: 26158806 - 26161319) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000717929 Chr17:26158633..26158805 TTTCTCATCATGCGATCCTG Chr17:26158689..26158708 59.76 45
downstream ENSMUSE00000395694 Chr17:26152889..26153100 TGCACTGTCTGTCACCTCGT Chr17:26153055..26153074 60.53 55
downstream ENSMUSE00000504071 Chr17:26152889..26153100 TGCACTGTCTGTCACCTCGT Chr17:26153055..26153074 60.53 55
downstream ENSMUSE00000254979 Chr17:26150719..26150862 TGTTCCTCACTGCCAATCAC Chr17:26150790..26150809 59.68 50
downstream ENSMUSE00000437075 Chr17:26148942..26149076 CTCAAGGCGGTTGATCTGTT Chr17:26148958..26148977 60.26 50
downstream ENSMUSE00000254908 Chr17:26145800..26145835 No primer for this exon
downstream ENSMUSE00000254889 Chr17:26141496..26141589 CTTGTCTGCAATGTCCTCCTC Chr17:26141474..26141494 59.86 52.38
downstream ENSMUSE00000254863 Chr17:26134874..26134977 AGCAGCTGCACTGTCCTTCT Chr17:26134902..26134921 60.35 55
downstream ENSMUSE00000254837 Chr17:26131131..26131271 ATGCTCTTCTCACGCTCCAT Chr17:26131133..26131152 59.98 50
downstream ENSMUSE00000254805 Chr17:26129527..26129608 GACCGCAGCTCACTGTTCTC Chr17:26129548..26129567 61.17 60
downstream ENSMUSE00000254788 Chr17:26128608..26128745 TGTCCCCCATTTTCCTCTTA Chr17:26128639..26128658 59.36 45
downstream ENSMUSE00000254775 Chr17:26128203..26128358 ACCTCCAGTCTGAGGAGCTG Chr17:26128281..26128300 59.58 60
downstream ENSMUSE00000254753 Chr17:26127921..26128061 CTCATCTCGGGAGACAGAGC Chr17:26127899..26127918 60.1 60
downstream ENSMUSE00000437003 Chr17:26125990..26127830 GCAAGTTGGTGATTGGTGTG Chr17:26126082..26126101 60.01 50
downstream ENSMUSE00000708467 Chr17:26125981..26127830 GCAAGTTGGTGATTGGTGTG Chr17:26126082..26126101 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCCTGCTCCTGCTTAAT Chr17:26161264..26161284 60.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTCGTGACTGGGAAAAC Chr17:26161253..26161273 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037098