Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36761
Trapped Gene
Elavl1 (ENSMUSG00000040028)
Vector Insertion
Chr 8: 4288346 - 4295562
Public Clones IST13876G9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000278547 (Chr8:4295336..4295561 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACAAACGGTCAGAAGCAG Chr8:4295511..4295530 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000278547 (Chr8:4295336..4295561 -)
Downstram Exon
ENSMUSE00000638319 (Chr8:4288347..4289924 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACAAACGGTCAGAAGCAG Chr8:4295511..4295530 60.03 50 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638320 Chr8:4324886..4325086 No primer for this exon
upstream ENSMUSE00000706646 Chr8:4324886..4324906 No primer for this exon
upstream ENSMUSE00000706645 Chr8:4312557..4312614 No primer for this exon
upstream ENSMUSE00000229444 Chr8:4311599..4311786 ACGAAGTCTGTTCAGCAGCA Chr8:4311644..4311663 59.78 50
upstream ENSMUSE00000229435 Chr8:4304927..4305030 CACACTGAACGGCTTGAGAC Chr8:4304947..4304966 59.47 55
upstream ENSMUSE00000229429 Chr8:4301685..4301838 GTTTGGGCGAATCATCAACT Chr8:4301712..4301731 59.94 45
upstream ENSMUSE00000278547 Chr8:4295336..4295561 TGACAAACGGTCAGAAGCAG Chr8:4295511..4295530 60.03 50
upstream ENSMUSE00000638319 Chr8:4288347..4289924 CTTGACGTTTGGGGTTCTGT Chr8:4288431..4288450 60.01 50

*** Putative Vector Insertion (Chr 8: 4288346 - 4295562) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706644 Chr8:4288344..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCACAAATAACTCGCTCA Chr8:4295590..4295611 60.12 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGAAGCGTGACTGGGAAA Chr8:4295498..4295518 60.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040028