Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36764
Trapped Gene
Col5a1 (ENSMUSG00000026837)
Vector Insertion
Chr 2: 27845612 - 27847513
Public Clones IST10080F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164065 (Chr2:27845558..27845611 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGGTACCCAGGAAGACAAG Chr2:27845584..27845603 60.74 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164065 (Chr2:27845558..27845611 +)
Downstram Exon
ENSMUSE00000227990 (Chr2:27847514..27847567 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGGTACCCAGGAAGACAAG Chr2:27845584..27845603 60.74 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000228220 Chr2:27742205..27742444 CTCCCTGAAGTTGTCGTGCT Chr2:27742230..27742249 60.44 55
upstream ENSMUSE00000336153 Chr2:27777537..27777704 CTCAGGGGTAACGAAAACCA Chr2:27777583..27777602 59.96 50
upstream ENSMUSE00000228203 Chr2:27783562..27783775 ATCCTGACAACCGTGAAAGC Chr2:27783588..27783607 60.12 50
upstream ENSMUSE00000228194 Chr2:27784899..27785061 CACCAATGGGATTGTCATGT Chr2:27785007..27785026 59.06 45
upstream ENSMUSE00000385107 Chr2:27805147..27805278 CAACCGAGCTGCCTATGACT Chr2:27805179..27805198 60.42 55
upstream ENSMUSE00000228180 Chr2:27806147..27806278 CCCCTACTCAGAAGCCAGTG Chr2:27806226..27806245 59.86 60
upstream ENSMUSE00000228173 Chr2:27806807..27807046 AGGGATCGGGGACTATGACT Chr2:27806881..27806900 59.78 55
upstream ENSMUSE00000228167 Chr2:27807793..27807966 ATTCACCGAGGAAACCATCA Chr2:27807831..27807850 60.32 45
upstream ENSMUSE00000662902 Chr2:27808489..27808545 AGAACCAGCCATCATTGAGC Chr2:27808524..27808543 60.23 50
upstream ENSMUSE00000662901 Chr2:27813742..27813783 No primer for this exon
upstream ENSMUSE00000400310 Chr2:27814005..27814067 CTACTGGCCAAATGGGTGAC Chr2:27814036..27814055 60.38 55
upstream ENSMUSE00000358384 Chr2:27815907..27815981 AGGTCTTCCTGGAGCTGATG Chr2:27815924..27815943 59.4 55
upstream ENSMUSE00000164084 Chr2:27817582..27817674 CCAGGCTATCCTCCAGCAAG Chr2:27817650..27817669 62.19 60
upstream ENSMUSE00000409711 Chr2:27819588..27819644 No primer for this exon
upstream ENSMUSE00000164074 Chr2:27820771..27820824 GTTTGAAAGGTGAGCCAGGA Chr2:27820790..27820809 60.23 50
upstream ENSMUSE00000364356 Chr2:27821117..27821170 CAACAGGGAAGCCTGGAAGA Chr2:27821148..27821167 62.63 55
upstream ENSMUSE00000228099 Chr2:27822450..27822503 TGGAAGTGATGGAGCCAGAG Chr2:27822458..27822477 61.36 55
upstream ENSMUSE00000375820 Chr2:27823659..27823712 CGGGAGAGAAAGGCCATAGA Chr2:27823693..27823712 61.6 55
upstream ENSMUSE00000568768 Chr2:27825265..27825318 GAATCCCAGGAGATGATGGA Chr2:27825293..27825312 59.82 50
upstream ENSMUSE00000568765 Chr2:27826967..27827011 GGTGACGATGGAGAAGTTGG Chr2:27826967..27826986 60.51 55
upstream ENSMUSE00000568763 Chr2:27828668..27828721 No primer for this exon
upstream ENSMUSE00000568761 Chr2:27829388..27829432 GGTGTAACGGGTATGGATGG Chr2:27829388..27829407 59.93 55
upstream ENSMUSE00000164071 Chr2:27829964..27830017 CCAGGACAGCAGGGTAATCC Chr2:27829988..27830007 61.81 60
upstream ENSMUSE00000604786 Chr2:27830213..27830257 TTGGTCCTCCAGGAGAAAAG Chr2:27830238..27830257 59.26 50
upstream ENSMUSE00000164082 Chr2:27831075..27831128 AACCAGGTCTCCCAGGAATG Chr2:27831088..27831107 61.28 55
upstream ENSMUSE00000568755 Chr2:27835992..27836036 TGGAAAAGAAGGTCCTCCAG Chr2:27836000..27836019 59.26 50
upstream ENSMUSE00000662900 Chr2:27836557..27836610 No primer for this exon
upstream ENSMUSE00000662899 Chr2:27840569..27840613 No primer for this exon
upstream ENSMUSE00000164067 Chr2:27842241..27842294 TTTAAAGGCGACATGGGAAT Chr2:27842262..27842281 59.41 40
upstream ENSMUSE00000164060 Chr2:27844659..27844766 CGAGGAGAAGATGGTCCTGA Chr2:27844683..27844702 60.34 55
upstream ENSMUSE00000164065 Chr2:27845558..27845611 GGGGTACCCAGGAAGACAAG Chr2:27845584..27845603 60.74 60

*** Putative Vector Insertion (Chr 2: 27845612 - 27847513) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227990 Chr2:27847514..27847567 No primer for this exon
downstream ENSMUSE00000164076 Chr2:27851226..27851270 GTCCTGGCTTTCCAGGTGTC Chr2:27851250..27851269 62.02 60
downstream ENSMUSE00000409138 Chr2:27851381..27851434 No primer for this exon
downstream ENSMUSE00000568753 Chr2:27852389..27852433 No primer for this exon
downstream ENSMUSE00000363521 Chr2:27853083..27853136 No primer for this exon
downstream ENSMUSE00000174757 Chr2:27854246..27854299 GTGTCCAGGGAGTCCGTCCT Chr2:27854281..27854300 63.83 65
downstream ENSMUSE00000568749 Chr2:27857090..27857143 No primer for this exon
downstream ENSMUSE00000164069 Chr2:27858003..27858110 No primer for this exon
downstream ENSMUSE00000386135 Chr2:27859381..27859470 No primer for this exon
downstream ENSMUSE00000164085 Chr2:27859562..27859615 CTTCACTGCCTTTGAGTCCA Chr2:27859592..27859611 59.01 50
downstream ENSMUSE00000164075 Chr2:27860699..27860806 No primer for this exon
downstream ENSMUSE00000174748 Chr2:27863268..27863375 CTTCTCCAGGAGGACCCACT Chr2:27863367..27863386 60.64 60
downstream ENSMUSE00000568741 Chr2:27864628..27864681 No primer for this exon
downstream ENSMUSE00000227922 Chr2:27865544..27865597 No primer for this exon
downstream ENSMUSE00000227912 Chr2:27865690..27865797 CATCTCCTTTCTGCCCAAAC Chr2:27865753..27865772 59.67 50
downstream ENSMUSE00000227901 Chr2:27866605..27866658 GTCTCCTGTCTCGCCCTTTT Chr2:27866649..27866668 60.77 55
downstream ENSMUSE00000392081 Chr2:27866762..27866869 CTTTTCTCCGACTGCACCAG Chr2:27866872..27866891 60.96 55
downstream ENSMUSE00000163346 Chr2:27868195..27868248 TCTCCAGCTTCACCAGGTTC Chr2:27868220..27868239 60.39 55
downstream ENSMUSE00000568732 Chr2:27868980..27869087 TCCCTTCTCCCCTCTTTCTC Chr2:27869012..27869031 59.75 55
downstream ENSMUSE00000163337 Chr2:27869627..27869680 GATCTCCAGGAAAGCCCACA Chr2:27869654..27869673 62.5 55
downstream ENSMUSE00000163356 Chr2:27869890..27869943 No primer for this exon
downstream ENSMUSE00000163368 Chr2:27871374..27871427 GATGGACCAGGTTCACCAGT Chr2:27871411..27871430 59.82 55
downstream ENSMUSE00000163373 Chr2:27871959..27872012 No primer for this exon
downstream ENSMUSE00000568721 Chr2:27872615..27872722 GGCCTTCTAAGCCAGCTTCT Chr2:27872639..27872658 60.12 55
downstream ENSMUSE00000163366 Chr2:27872801..27872854 No primer for this exon
downstream ENSMUSE00000163339 Chr2:27872946..27872999 GGACCGGAGTCTCCTTTGAG Chr2:27872989..27873008 61.16 60
downstream ENSMUSE00000353216 Chr2:27873961..27874068 CACCCTTTTCACCTTGCTCT Chr2:27874021..27874040 59.33 50
downstream ENSMUSE00000163338 Chr2:27875457..27875510 No primer for this exon
downstream ENSMUSE00000662898 Chr2:27876288..27876323 CGAAGAGCCCTTAGCACCTT Chr2:27876326..27876345 60.88 55
downstream ENSMUSE00000163359 Chr2:27877801..27877854 No primer for this exon
downstream ENSMUSE00000163372 Chr2:27880125..27880380 TGGTCGCTTCATCTGTTCAA Chr2:27880313..27880332 60.39 45
downstream ENSMUSE00000163375 Chr2:27881113..27881225 TTGGGATCGACCCAGTATTC Chr2:27881137..27881156 59.75 50
downstream ENSMUSE00000163369 Chr2:27884487..27884555 TCTTTGGGCCAAGAAGTGAT Chr2:27884515..27884534 59.67 45
downstream ENSMUSE00000333885 Chr2:27888111..27888344 CCAAGAAGCGGATAGCCTTA Chr2:27888279..27888298 59.45 50
downstream ENSMUSE00000227807 Chr2:27892390..27893044 TTGGCGACCTTTACAAGACC Chr2:27892941..27892960 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTACCCAGGAAGACAAGG Chr2:27845586..27845606 60.74 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGACAAGGGCCAAAGGTAA Chr2:27845596..27845617 60.47 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026837