Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36768
Trapped Gene
Dnajb14 (ENSMUSG00000074212)
Vector Insertion
Chr 3: 137555918 - 137565150
Public Clones IST13881E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000586538 (Chr3:137555772..137555917 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000586538 (Chr3:137555772..137555917 +)
Downstram Exon
ENSMUSE00000586537 (Chr3:137565151..137565336 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AATTGAACCTGCCGTTGTTC Chr3:137565264..137565283 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352480 Chr3:137530838..137531020 GAAGGCCGAGAAGCTGTACC Chr3:137530983..137531002 61.29 60
upstream ENSMUSE00000586546 Chr3:137548237..137548408 GGCGGGAAAGTCTATACCAA Chr3:137548365..137548384 59.04 50
upstream ENSMUSE00000586538 Chr3:137555772..137555917 No primer for this exon

*** Putative Vector Insertion (Chr 3: 137555918 - 137565150) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000586537 Chr3:137565151..137565336 AATTGAACCTGCCGTTGTTC Chr3:137565264..137565283 59.98 45
downstream ENSMUSE00000586536 Chr3:137566847..137566941 GTGTCGGTGCTGATGTTGAT Chr3:137566911..137566930 59.56 50
downstream ENSMUSE00000635680 Chr3:137567709..137567818 GGACACAAGGATCAGCACAA Chr3:137567768..137567787 59.68 50
downstream ENSMUSE00000635679 Chr3:137568849..137569021 TGCTGTCTTTCTTTCCAGCA Chr3:137569022..137569041 59.72 45
downstream ENSMUSE00000562411 Chr3:137571309..137571548 CGGTACACTTTGGCTGCATA Chr3:137571345..137571364 59.75 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr3:137561967..137561988 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGGCCCATTACGTGACT Chr3:137555956..137555976 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074212