Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36775
Trapped Gene
1700009P17Rik (ENSMUSG00000026649)
Vector Insertion
Chr 1: 173053325 - 173055165
Public Clones IST14893E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000494744 (Chr1:173053177..173053324 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCAGGCAACAAGTGTAAA Chr1:173053266..173053285 60.29 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000494744 (Chr1:173053177..173053324 +)
Downstram Exon
ENSMUSE00000535859 (Chr1:173055166..173055227 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCAGGCAACAAGTGTAAA Chr1:173053266..173053285 60.29 45 GAGACCAGTTCTGCAGGTACG Chr1:173055209..173055229 59.92 57.14

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495823 Chr1:173051792..173051952 AACCTGGTTGGCTCACATTT Chr1:173051906..173051925 59.45 45
upstream ENSMUSE00000494744 Chr1:173053177..173053324 TGCCAGGCAACAAGTGTAAA Chr1:173053266..173053285 60.29 45

*** Putative Vector Insertion (Chr 1: 173053325 - 173055165) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496838 Chr1:173055165..173055227 GAGACCAGTTCTGCAGGTACG Chr1:173055209..173055229 59.92 57.14
downstream ENSMUSE00000535859 Chr1:173055166..173055227 GAGACCAGTTCTGCAGGTACG Chr1:173055209..173055229 59.92 57.14
downstream ENSMUSE00000535860 Chr1:173055401..173055481 AAGAGATGCCCTCGATCGTT Chr1:173055462..173055481 61.13 50
downstream ENSMUSE00000658698 Chr1:173055401..173055416 No primer for this exon
downstream ENSMUSE00000519216 Chr1:173055419..173055481 AAGAGATGCCCTCGATCGTT Chr1:173055462..173055481 61.13 50
downstream ENSMUSE00000479738 Chr1:173056165..173056341 AGGTTGTCGGCAGCTGTAGT Chr1:173056271..173056290 59.94 55
downstream ENSMUSE00000687473 Chr1:173056695..173057098 CAGCATGGCATAGATCTGGA Chr1:173056957..173056976 59.78 50
downstream ENSMUSE00000706641 Chr1:173056695..173056916 TCTGGGTTGTCTCCTTGGAT Chr1:173056813..173056832 59.51 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGCTCGTCACCCTTTTA Chr1:173053332..173053352 60.39 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGCTCGTCACCCTTTTA Chr1:173053332..173053352 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026649