Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36793
Trapped Gene
4930511I11Rik (ENSMUSG00000024223)
Vector Insertion
Chr 17: 28674898 - 28675530
Public Clones IST14972F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139956 (Chr17:28674826..28674897 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTCCGCCTCCTGAGTTAC Chr17:28674833..28674852 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139956 (Chr17:28674826..28674897 +)
Downstram Exon
ENSMUSE00000139964 (Chr17:28675531..28676052 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTCCGCCTCCTGAGTTAC Chr17:28674833..28674852 59.87 60 CCCGTACGCATTTATTGGAT Chr17:28675896..28675915 59.68 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000139966 Chr17:28667806..28667991 GGACCTCATCAAAAGCTTCG Chr17:28667864..28667883 59.81 50
upstream ENSMUSE00000139958 Chr17:28668920..28669065 CTCCGGTGAGATTCGAAGAC Chr17:28668954..28668973 59.8 55
upstream ENSMUSE00000139960 Chr17:28669288..28669422 TGGATGACATCGACTTGGTG Chr17:28669304..28669323 60.53 50
upstream ENSMUSE00000139962 Chr17:28674498..28674671 ACGTAGCTGGTCTCCGATTG Chr17:28674553..28674572 60.28 55
upstream ENSMUSE00000139956 Chr17:28674826..28674897 CTGTCCGCCTCCTGAGTTAC Chr17:28674833..28674852 59.87 60

*** Putative Vector Insertion (Chr 17: 28674898 - 28675530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139964 Chr17:28675531..28676052 CCCGTACGCATTTATTGGAT Chr17:28675896..28675915 59.68 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCTGGCACAGAAGAACGA Chr17:28674851..28674871 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACGTGACTGGGAAAAC Chr17:28674944..28674964 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024223