Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36803
Trapped Gene
Jarid1d (ENSMUSG00000056673)
Vector Insertion
Chr Y: 237057 - 246890
Public Clones IST14648G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568659 (ChrY:236922..237056 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568659 (ChrY:236922..237056 +)
Downstram Exon
ENSMUSE00000568658 (ChrY:246891..247029 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGGCCCAAGCCTATCATCT ChrY:246986..247005 60.57 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403858 ChrY:234231..234558 ACCGAACGAGGAGGTGAATA ChrY:234255..234274 59.55 50
upstream ENSMUSE00000568662 ChrY:234993..235070 ATTGGCAACCTCCTTTTGCT ChrY:234994..235013 60.99 45
upstream ENSMUSE00000568661 ChrY:235871..235993 TGTGGAGAGGAAGATCTTGGA ChrY:235954..235974 59.79 47.62
upstream ENSMUSE00000568660 ChrY:236230..236400 CCCACTACGAACGGATCATT ChrY:236342..236361 59.81 50
upstream ENSMUSE00000568659 ChrY:236922..237056 No primer for this exon

*** Putative Vector Insertion (Chr Y: 237057 - 246890) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568658 ChrY:246891..247029 GAGGCCCAAGCCTATCATCT ChrY:246986..247005 60.57 55
downstream ENSMUSE00000568655 ChrY:247129..247292 TGCTGTGATTGTTCCGTAGC ChrY:247284..247303 59.87 50
downstream ENSMUSE00000568653 ChrY:250468..250626 CATCCCCACGAGAGCATATT ChrY:250510..250529 59.92 50
downstream ENSMUSE00000568651 ChrY:253084..253203 CCTTGAAGGAGTCAGCCATC ChrY:253180..253199 59.8 55
downstream ENSMUSE00000447886 ChrY:253289..253447 ACATCCTCCTCAATGCTGCT ChrY:253356..253375 59.83 50
downstream ENSMUSE00000568648 ChrY:257845..258026 AGCACTGGCATCACATTGAG ChrY:257891..257910 59.86 50
downstream ENSMUSE00000568646 ChrY:258117..258279 GTTCTGCTGCTAGCGAAGGT ChrY:258166..258185 59.79 55
downstream ENSMUSE00000568645 ChrY:263450..263569 AATGACAAATTCCCCTGCAC ChrY:263491..263510 59.8 45
downstream ENSMUSE00000568643 ChrY:263688..263882 TTCAATACACTGGCGTCCAA ChrY:263717..263736 60.11 45
downstream ENSMUSE00000568642 ChrY:264153..264334 CTTGATGCACTGACGCTCAT ChrY:264221..264240 60.02 50
downstream ENSMUSE00000568638 ChrY:264413..264537 ACTTTGTTGGCCCAGTTGTC ChrY:264502..264521 60.01 50
downstream ENSMUSE00000568637 ChrY:264680..264827 TGGGAAATACAAGCCTCTGC ChrY:264797..264816 60.21 50
downstream ENSMUSE00000568633 ChrY:273319..273415 GTAAGGGTGATTTGCGGTGT ChrY:273348..273367 59.86 50
downstream ENSMUSE00000568631 ChrY:274256..274614 CTCACGGGTCTCAATTTGGT ChrY:274303..274322 59.97 50
downstream ENSMUSE00000568630 ChrY:276262..276400 TTCACATCAGCAATCCAAGC ChrY:276393..276412 59.81 45
downstream ENSMUSE00000568629 ChrY:277042..277221 AATCCCGACCAACAGCTACA ChrY:277105..277124 60.52 50
downstream ENSMUSE00000568628 ChrY:277348..277485 CCTTTTCAATCCACCGACTG ChrY:277414..277433 60.49 50
downstream ENSMUSE00000568627 ChrY:277670..278266 CTGTAGTTGTTGGCGGGATT ChrY:278179..278198 59.99 50
downstream ENSMUSE00000568626 ChrY:278674..278755 No primer for this exon
downstream ENSMUSE00000568625 ChrY:278885..279084 TGCGCTCTAGATTGGGATTC ChrY:279070..279089 60.32 50
downstream ENSMUSE00000508503 ChrY:279267..280254 CCCCAAGTATTGGCTTTTGA ChrY:279459..279478 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAAGGCTACAGCCTGAGGT ChrY:243040..243060 58.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAGGCTACAGCCTGAGGT ChrY:243040..243060 58.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056673